Exiqon

The detection of expression levels of tRF-Glu49 in 92 pairs of cervical tissue was achieved through ISH based on probes for tRF-Glu49 (Exiqon; Qiagen). The sequence was TGGTTCCCTGACCGGGAATGCAACCCG with a DIG label at the 5′ and 3′ ends. Researchers displaced TMA into an oven at 60°C for 60 min, and it was incubated as slides overnight at 4°C. Deparaffinized slide was within the solution of ethanol and xylene at room temperature, and subsequently, incubation was achieved by employing Proteinase-K for 7.5 min at 37°C. Slides received 20 min hybridization using a 1,000 nmol/l tRNA-Glu49 probe within one hybridization buffer at 50°C, and subsequently, the cleaning process was performed by employing SSC buffer. The remaining procedure was carried out by employing a revised producer's guideline (20 (link)). tRF-Glu49 staining received an intensity scoring based on the 0–2 scale, in accordance with the 1.5-2 (strong), 0.5-1.5 (medium) and 0–0.5 (weak) staining standard. Based on the intensities multiplied by the percentages of positive cells, the aforementioned expression scores were determined. Based on a blind approach, two pathologists assessed a single specimen, and specimens with a score over 1 were considered to show high expression, and those with a score less than or equal to 1 were considered to show low expression.

Cells were seeded in 12-well plates (150,000 cells/well) and transfected 24 h later with 100 nM antisense oligonucleotide targeting miR-194-5p or miR-608 as control (miR-608 is not expressed in Hep G2 cells) (Exiqon, Qiagen) using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, L3000008). 48 h later cells were harvested. For RNA extraction, cells were collected in QIAzol with RNA extraction as above. For protein extraction, cells were washed in PBS and lysed in 140 μl of RIPA buffer (see Supp. materials and methods) containing Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail (1:100; Cell Signaling Technology, 5871 and 5870). Cells were incubated for 20 min on ice, collected and centrifuged twice (15 min, 20,000 g, 4 °C). Supernatants were transferred to fresh tubes and protein concentration was determined by Lowry assay (Bio-Rad, 5000113).

Total cellular RNA was isolated using TRIzol (Thermo Fisher Scientific, Inc.). For isolation of EV-RNA, cells were cultured in monoculture or 2D co-culture. After 48 h, the media was removed and centrifuged at 3,000 × g for 15 min, EVs were isolated using ExoQuick-TC (System Biosciences, LLC) and EV-RNA was isolated using SeraMir (Systems Biosciences, LLC). The final concentration of the cellular RNA or EV-RNA was measured using a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Inc.). RNA sequencing was performed by Exiqon (Qiagen Sciences, Inc.).