Total PVN RNA was extracted using the RNA‐easy™ Isolation Reagent (Vazyme Biotech Co.). A PrimeScript™ RT kit (Vazyme Biotech Co.) was used for reverse transcription. Relative mRNA level was detected by in a Bio‐Rad iQ5 Multicolor Real‐Time PCR system (Bio‐Rad Laboratories, CA, USA) with SYBR Green (Vazyme Biotech Co.). The 2−ΔΔCt method was used to calculate the relative targeted gene expression and normalized to GAPDH expression. Primer sequences were listed in Table 1 .
Iq5 multicolor real time pcr system
Manufactured by Bio-Rad
Sourced in United States
The IQ5 multicolor real-time PCR system is a laboratory instrument designed for performing real-time polymerase chain reaction (PCR) analysis. It allows for the simultaneous detection and quantification of multiple DNA targets within a single sample. The system is capable of using up to five different fluorescent dyes to monitor gene expression, SNP genotyping, pathogen detection, and other applications that require sensitive and precise real-time PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Itaq universal sybr green supermix, by Bio-Rad (4 mentions)
Primescript rt kit, by Vazyme (3 mentions)
Sybr green, by Vazyme (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Rna easy isolation reagent, by Vazyme (2 mentions)
M mulv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Nanodrop 3300 fluorospectrometer, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (2 mentions)
Goscript reverse transcription system, by Promega (2 mentions)
M mlv reverse transcriptase, by Tiangen Biotech (1 mentions)
Sybr mixture, by CWBIO (1 mentions)
Mmlv reverse transcription system, by Thermo Fisher Scientific (1 mentions)
Sybr green real time rt pcr master mix, by Toyobo (1 mentions)
Sybr green master mixes, by Thermo Fisher Scientific (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Iq sybr green supermix kit, by Bio-Rad (1 mentions)
18 protocols using iq5 multicolor real time pcr system
1
PVN RNA Extraction and Analysis
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the TRIzol reagent and reverse transcription was performed using a PrimeScript™ RT kit (R323-01; Vazyme, China). Relative RNA expression levels were determined using a Bio-Rad iQ5 multicolor real-time PCR system (Bio-Rad Laboratories, USA) with SYBR Green (Q711; Vazyme, China). The 2−ΔΔCt method was used to calculate the relative targeted gene expression. Normalization was performed with GAPDH. The primer sequences are listed in Supplementary Table 1 .
3
Cardiac Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cardiac tissues using the RNA-easy™ Isolation Reagent (Vazyme Biotech Co.). A PrimeScript™ RT kit (Vazyme Biotech Co.) was used for reverse transcription. Relative mRNA level was detected by in a Bio-Rad iQ5 Multicolor Real-Time PCR system (Bio-Rad Laboratories, CA, USA) with SYBR Green (Vazyme Biotech Co.). The 2 -ΔΔCt method was used to calculate the relative targeted gene expression and normalized to GAPDH expression. The primer sequences were as follows: TRAF6, forward, 5
4
Quantitative PCR of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol reagent (Carlsbad, CA, Invitrogen, USA). One micro-gram of RNA was reverse transcribed to cDNA using the M-MLV Reverse Transcriptase (Tiangen, Beijing, China) according to the manufacturer’s instructions. Quantitative PCR was performed using SYBR Mixture (CWBIO, Beijing, China), and the fluorescence signal was detected by iQ5 Multicolor real-time (RT)-PCR system (Bio-Rad, Hercules, CA, USA). PCR primer for human was as follows: glyceraldehyde-3-phosphate dehydroge-nase (GAPDH), 5′-GAAGGTGAAGGTCGGAGTC-3′ (sense), 5′-GAAGATGGTGATGGGATTTC-3′ (antisense); miR-3960 stem-loop, 5′-GTATCCAG TGCAGGGTCCGAGGTATTCG CACTGGATACGACCCCCCG-3′; miR-3960 forward, 5′-ATATATAGGCGGCGGCGGA-3′; universal reverse for miRNA, 5′-GTGCAGGGTCCGAGGT-3′; U6, 5′-CTCGCTTCGGCAGCACA-3′ (sense), 5′-AACGCTTCACGAATTTGCGT-3′ (antisense); HOTAIRM1, 5′-CCCACCGTTCAATGAAAGATG-3′ (sense), 5′-TCAAACACCCACATTTCAACC-3′ (antisense); HOXA1, 5′-CAAAAGAAACCCTCCCAAAAC-3′ (sense), 5′-CGTCAGGTACTTGTTGAAG-3′ (antisense). GAPDH was used as an endogenous control. Fold changes were calculated using the 2−ΔΔCt method. PCRs were conducted in triplicate for each sample. All the reactions were performed in triplicate.
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent (Invitrogen). 1 μg of RNA was reverse transcribed with the M-MLV Reverse Transcription System (Invitrogen) according to the manufacture’s instructions. PCR was performed using the SYBR Green Real-time RT-PCR Master Mix plus (TOYOBO) as described by the manufacture. PCR primers used here were as follows. GAPDH: 5′-TGCACCACCAACTGCTTAG-3′ (sense), 5′-GATGCAGGGATGATGTTC-3′ (antisense); p38: 5′-ACAAACCAAGTCATCAAGG-3′ (sense), 5′-ATCAGAAGGAACCACACT-3′ (antisense); IL6: 5′-AACGATGATGCACTTGCAGA-3′ (sense), 5′-GAGCATTGGAAATTGGGGTA-3′ (antisense). Amplification was performed by denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec. GAPDH was performed on each experimental sample as an endogenous control. The real-time RT-PCR was carried out in a Bio-rad IQ 5 Multicolor real-time RT-PCR system and their software was used to calculate the cycle threshold of each reaction. All reactions were run in triplicate.
6
Quantitative Real-Time PCR Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA measurement was performed using a Nanodrop, ND-8000 (8-sample spectrophotometer, USA). RNA sample absorbance was measured at 230 nm, 260 nm, and 280 nm.
The primer for the mip gene was previously designed by Forsbach-Birk et al. (2013) (link), the primers of pmp18D and ompA genes were designed by Wheelhouse et al. (2009) (link) (Table I ), while the GAPDH primer was designed for this study. Profiling was executed using a real-time PCR-based array and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) transcript as a normalization signal. The AddRT-qPCR SYBR kit (Add Bio, Korea), a single tube real-time one-stepRT-qPCR, was used in this study. Furthermore, q-PCR was undertaken in an IQ5 Multicolor Real-time PCR system (BIO-RAD, USA).
The primer for the mip gene was previously designed by Forsbach-Birk et al. (2013) (link), the primers of pmp18D and ompA genes were designed by Wheelhouse et al. (2009) (link) (
7
Validation of Differentially Expressed Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
14 DEGs were randomly selected for validation using quantitative real-time PCR. Primers for real-time PCR, which were designed with the Primer3, (v.4.0.0) software, are listed in Supplementary Table S5 . For each sample, first-strand cDNAs were reverse-transcribed from RNAs treated with DNase I (Fermentas, Canada) using M-MuLV Reverse Transcriptase (Fermentas, Canada) according to the manufacturer’s instructions. RT-qPCR was performed using an optical 96-well plate with an iQ5 multicolor real time PCR system (Bio-RAD, USA). Each reaction contained 1.0 μL of cDNA template from the reverse-transcribed reaction mentioned above, 10-nM gene-specific primers, 10 μL of iTaq™ Universal SYBR Green supermix (Bio-RAD, USA) in a final volume of 20 μL. The EF1α gene was selected for the internal control73 (link). The thermal cycle used was as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 30 s. The real-time PCR analysis was performed with three biological replicates for each sample and three technical replicates of each biological replicate. The transcript level of each gene was normalized and fold change was calculated using standard 2−ΔΔCT method.
8
Quantitative Gene Expression Analysis
9
Comprehensive qRT-PCR Analysis of BnWRKY Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted the total RNA using the RNAPrep Pure plant kit (Tiangen Biotech, Beijing, China). The complementary DNA was synthesized by the GoScript reverse transcription system (Promega, Madison, WI, USA). qRT-PCR analysis was conducted via an iQ5 multicolor real-time PCR system (Bio-Rad, Hercules, CA, USA). Here we analyzed the expression of 25 BnWRKY genes from three subgroups [23 (link)]. The primers (Table S1 ) applied to qRT-PCR were generated from the Primer3 website (http://primer3.ut.ee/ , accessed on 1 June 2015) and were further evaluated by Oligo 7 (Molecular Biology Insights Inc., Cascade, CO, USA). The EF1A gene was selected as a reference gene. Three biological and technical replicates were performed, and the relative expression levels were calculated based on the comparative cycle threshold (2−∆∆Ct) values [46 (link)]. Heatmap Illustrator 1.0 was used to generate a comprehensive presentation of gene expression under the different tested conditions.
10
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA extracted from the different H5 and DZ development stages were used for qRT-PCR. Reverse cDNA for each sample was generated using the GoScript Reverse Transcription System (Promega, USA), according to the manufacturer's instructions. An optical 96-well plate iQ5 multicolor real time PCR system (Bio-RAD, USA) was used for the qRT-PCR. Each reaction contained 1 µL of cDNA template, 10 nM gene-specific primers, 10 µL of iTaq Universal SYBR Green Supermix (Bio-RAD, USA) and 7 µL of ddH2O in a final volume of 20 µL. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected as the endogenous control [43] (link). Gene-specific primers (Table S1 ) were designed, according to the cDNA sequences, using Primer 3 (http://primer3.ut.ee/ ), which were synthesized commercially by Sunny Biotech, Shanghai. The thermal cycle used was as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. Following amplification, a dissociation stage was carried out to detect any complex products. The qRT-PCR was performed in triplicate for each sample. Relative expression levels were calculated as described previously [44] (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!