OTUB1 gRNA (sequence: AGAATCCTCTGGTGTCAGAG) was cloned into lentiCas9‐Blast (Plasmid #52962, Addgene, USA). For lentivirus package, lentiCas9‐Blast‐OTUB1 gRNA plasmids were transfected into 293T cells together with pMD2.G and psPAX2 plasmids. The medium containing lentivirus was harvested at 48 h after transfection. Then, lentivirus was added to 4T1 cell cultures with 8 μg/mL polybrene (Sigma‐Aldrich). Seventy‐two hours after transduction, 4 μg/mL blasticidin (Yeasen Biotechnology, Shanghai) was used to select single‐cell clones. The ablation efficiency was confirmed by Western blot.
Blasticidin
Manufactured by Yeasen
Sourced in China
Blasticidin is a selection antibiotic used in cell culture applications. It functions by inhibiting protein synthesis in eukaryotic cells.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Merck Group (2 mentions)
Lenticas9 blast, by Addgene (2 mentions)
Lysotracker red dnd 99, by Thermo Fisher Scientific (1 mentions)
Oleic acid, by Merck Group (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Peptide n glycosidase f, by New England Biolabs (1 mentions)
Mevalonolactone, by Merck Group (1 mentions)
Filipin, by Merck Group (1 mentions)
Anti flag m2 affinity gel, by Merck Group (1 mentions)
Endoglycosidase h, by New England Biolabs (1 mentions)
Epicm, by ScienCell (1 mentions)
Hygromycin, by Yeasen (1 mentions)
Pspax2, by Addgene (1 mentions)
Lenticas9 blast plasmid, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
5 protocols using blasticidin
1
Establishing OTUB1 Knockout 4T1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
OTUB1 gRNA (sequence: AGAATCCTCTGGTGTCAGAG) was cloned into lentiCas9‐Blast (Plasmid #52962, Addgene, USA). For lentivirus package, lentiCas9‐Blast‐OTUB1 gRNA plasmids were transfected into 293T cells together with pMD2.G and psPAX2 plasmids. The medium containing lentivirus was harvested at 48 h after transfection. Then, lentivirus was added to 4T1 cell cultures with 8 μg/mL polybrene (Sigma‐Aldrich). Seventy‐two hours after transduction, 4 μg/mL blasticidin (Yeasen Biotechnology, Shanghai) was used to select single‐cell clones. The ablation efficiency was confirmed by Western blot.
+ Expand
OTUB1 gRNA (sequence: AGAATCCTCTGGTGTCAGAG) was cloned into lentiCas9‐Blast (Plasmid #52962, Addgene, USA). For lentivirus package, lentiCas9‐Blast‐OTUB1 gRNA plasmids were transfected into 293T cells together with pMD2.G and psPAX2 plasmids. The medium containing lentivirus was harvested at 48 h after transfection. Then, lentivirus was added to 4T1 cell cultures with 8 μg/mL polybrene (Sigma‐Aldrich). Seventy‐two hours after transduction, 4 μg/mL blasticidin (Yeasen Biotechnology, Shanghai) was used to select single‐cell clones. The ablation efficiency was confirmed by Western blot.
2
Lipoprotein Pathway Regulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mevalonolactone (No. M4667), filipin (No. F9765), oleic acid (No. O1008), 25-HC (No. H1015) and anti-Flag M2 Affinity Gel (No. A2220) were from Sigma-Aldrich. LysoTracker Red DND-99 (No. L7528) and DAPI (No. D3571) were from Invitrogen. Blasticidin (No. 60218ES10) was from Yeasen. Endoglycosidase H (No. P0703S) and peptide N-glycosidase F (No. P0704S) were from New England Biolabs. Lipoprotein-deficient serum (LPDS, density >1.215 g/mL) was prepared from newborn calf serum by ultracentrifugation in our laboratory.
3
Optimized Culture Conditions for Gallbladder Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the primary cells in this study were cultured in EpiCM (4101, Sciencell (San Diego, California, USA)), but we modified the kit instruction with the replacement of 2% FBS instead of 10% FBS to culture all single cell clones including the epithelial clone L-2F7 and fibroblast clone L-G33. As immortalized gene vectors harbored antibiotic resistance genes, hygromycin (60224ES03, Yeasen) and blasticidin (60218ES10, Yeasen (Shanghai, China)) were selected at concentrations of 200 and 10µg/ml, respectively. The gallbladder cancer cell (GBC) lines NOZ, GBC-SD, ZJU-0430, and OCUG1 were authenticated by Short tandem (STR) repeat and tested if mycoplasma-free. The four GBC cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) (SH30243.01, Hyclone (Logan, Utah, USA)) with 10% FBS and 1% penicillin–streptomycin solution (60162ES76, Yeasen (Shanghai, China)). All the cells were digested by a trypsin solution (40127ES60, Yeasen) before passaging or being frozen with a cell-saving buffer (C30100, NCM (Suzhou, Jiangsu Province, China) Biotech).
4
BRCA2 Knockout Cell Competition Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF10A Cas9-stable cells were transduced with virus particles expressing U6-mCherry-sgBRCA2. Twenty-four hours after transfection, the virally transduced cells were selected using 750 μg/mL of G418 (Yeasen, 60220ES03). One day after infection, sgBRCA2-expressing cells were transduced with virus particles expressing U6-sgNeg-EGFP or U6-sgNSFL1C-EGFP. Twenty-four hours after transfection, the virally transfected cells were selected using 10 μg/mL of blasticidin (Yeasen, 60218ES10) and 750 μg/mL of G418. Two days after transfection, sgBRCA2- and EGFP-expressing cells (double transfection) were mixed 1:1 (3,000 cells each) and seeded in a 12-well Nest plate (Nest, 712001). The proportion of GFP-positive cells was measured by flow cytometry at 0, 1, 3, 5, and 7 days.
5
Lentiviral Transduction and Gene Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
USP25 gRNA (AGTGCACACAGGTTTACTGG) was inserted into the lentiCas9‐Blast plasmid (#52 962, Addgene). The lentiCas9‐Blast‐USP25 gRNA plasmids were then co‐transfected into 293T cells together with pMD2.G (#12 259, Addgene) and psPAX2 (#12 260, Addgene) plasmids for virus production, and lentivirus‐containing supernatant was collected 48 h after transfection. BV2 cells were transduced with the lentivirus in the presence of 6 µg ml−1 polybrene (Sigma Aldrich). On day 3 after transduction, 4 µg ml−1 blasticidin (Yeasen Biotechnology, Shanghai, China) was added to select single‐cell clones. The USP25−/− NIH/3T3 cells were generated similarly. The deletion of USP25 in selected cell clones was verified by western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!