As described in our previous study (25 (link)), EpiQuik™ Tissue ChIP Kit (P-2012; Epigentek Group Inc., Farmingdale, NY, USA) was used to perform the ChIP assay according to the manufacturer's protocol. In brief, the acetylated histone H3 antibody (1 µg, Epigentek Group Inc.) or 1 µl of normal mouse IgG (as a negative control) was used to pre-coat the assay wells. Meanwhile, 30 mg of heart tissue was cut into little pieces and cross-linked with 1% formaldehyde. The cross-link was stopped by glycine solution (1.25 M). After tissue disaggregation and the nuclei isolation, the DNA was sheared by sonication (S-450-Dwithmicro-tip probe; Emerson Industrial, St. Louis, MO, USA) with 5 pulses of 20 s each separated by 40 s rest on ice (output control: 2). After centrifugation, 5 µl of the diluted supernatants were used as input DNA. The other diluted supernatant (100 µl) was added to the acetylated histone H3 antibody-coated wells followed by incubation at room temperature for 60 min. ChIP-enriched DNA fragments were precipitated, purified, and assayed by quantitative PCR with the following primers: DUSP5 forward 5’ CTGACACTCCACCGGTAGTC 3’, reverse 5’ GGGCGTCTTAGAGCGAGAAA 3’. The value was computed relative to a calibrator (2−ΔΔCt) and normalized to the input.
Epiquik tissue chip kit
Manufactured by Epigentek
Sourced in United States
The EpiQuik Tissue ChIP Kit is a complete ChIP (Chromatin Immunoprecipitation) assay kit designed for the analysis of protein-DNA interactions in tissue samples. The kit contains all necessary reagents and materials for the efficient extraction, shearing, and immunoprecipitation of chromatin from tissue samples.
Automatically generated - may contain errors
Lab products found in correlation
Bioruptor ultrasonicator, by Diagenode (1 mentions)
Yy1 antibody, by Santa Cruz Biotechnology (1 mentions)
H3k9ac, by Epigentek (1 mentions)
Sybr green qpcr master mix, by Thermo Fisher Scientific (1 mentions)
Ab8895, by Abcam (1 mentions)
Ab1220, by Abcam (1 mentions)
Ab91252, by Abcam (1 mentions)
Ab4729, by Abcam (1 mentions)
Rabbit igg 3900, by Cell Signaling Technology (1 mentions)
7 protocols using epiquik tissue chip kit
1
Chromatin Immunoprecipitation of Acetylated Histone H3
2
Chip-seq protocol for zebrafish embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chip test was performed using Epiquik Tissue Chip Kit (Epigentek, USA). Zebrafish embryos at 24 hpf were collected and dechorionated manually, followed by in vivo cross-link process with 1 ml 1% formaldehyde solution incubating for 15–20 min on a rocking platform. After washing by 1 ml 125 mM Glycine solution for 5 min, the embryos were homogenized by adding 1 ml Homogenizing Buffer. The homogenized mixture was centrifuged to remove supernatant, and the disaggregated tissue pellet was resuspended by 500 ul Lysis buffer. After incubation for 15 min on ice, the mixture was sheared using the Bioruptor® ultrasonicator (Diagenode, Belgium). The sonication factor is: 30 s work, 30 s intervals, 5cycles, rest for 2 min; repeat the work. The length of sheared DNA should be between 200–1000 bp. Sheared DNA could be used to do the protein-DNA immunoprecipitation and DNA reversal. These progresses were performed according to the Epiquik Tissue Chip Kit manual book.
The primers for qPCR was designed in primer premier 5.0 (see Supplementary FigureS4 ).
The primers for qPCR was designed in primer premier 5.0 (see Supplementary Figure
3
ChIP Assay for Acetylated Histone H3 in Heart Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described in our previous study [15 (link)], EpiQuik™ Tissue ChIP Kit (P-2012; Epigentek Group Inc., Farmingdale, NY, USA) was used to perform the ChIP assay according to the manufacturer’s protocol. In brief, the c-Jun antibody (1 μg) or 1 μl of normal mouse IgG (as a negative control) was used to pre-coat the assay wells. Meanwhile, 30 mg of heart tissue was cut into little pieces and cross-linked with 1% formaldehyde. The cross-link was stopped by glycine solution (1.25 M). After tissue disaggregation and the nuclei isolation, the DNA was sheared by sonication (S-450-Dwithmicro-tip probe; Emerson Industrial, St. Louis, MO, USA) with 5 pulses of 20 s each separated by a 40 s rest on ice (output control: 2). After centrifugation, 5 μl of the diluted supernatants were used as input DNA. The other diluted supernatant (100 μl) was added to the acetylated histone H3 antibody-coated wells followed by incubation at room temperature for 60 min. ChIP-enriched DNA fragments were precipitated, purified, and assayed by quantitative PCR with the following primers: miR-221 forward 5′-GCTAAAGAGGGGGAGCAATC-3′, reverse 5′-CTGCTCTTTGAGGGAGGACAA-3′. The value of the ChIP samples was normalized to the input and was presented as a percentage of control.
4
Chromatin Immunoprecipitation for YY1 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation was performed using EpiQuik tissue ChIP Kit (Epigentek, Farmingdale, NY) and YY1 antibody (Santa Cruz; Protein A/G PLUS‐Agarose was used), according to the manufacturer's instruction, using NPC tissue samples with different SNP genotypes and genders. After precipitation, primer set for rs117565607 (chr6_30280350) (forward: 5′‐GTTGAGTATGAGAGATGTGAGCAG‐3′, reverse: 5′‐ATAAAAGGGCAGAA CCATAGCAG‐3′) was used for enrichment by conventional PCR.
5
ChIP Analysis of HMGB1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed while using EpiQuik Tissue ChIP Kit (Epigentek, Farmingdale, NY, USA) consistent with a modified manufacturer protocol. The dissected ZDF spinal cord samples were excised into smaller pieces (1–2 mm3). The sliced and crushed samples were incubated with fresh 1% paraformaldehyde to cross-link proteins to DNA on a shaker for 15–20 min at 25–30 °C. Subsequently, instructions from the protocol were followed accordingly. Chromatin fragments were generated from the sheared lysates procedure by sonication. The input control for PCR was saved from the sonicated chromatin. The chromatin was then immunoprecipitated for 2 h at RT with antibody against H3K9ac (Epigentek, Farmingdale, NY, USA) or control IgG. The protein—DNA immunocomplexes were precipitated while using spin columns and several steps were followed, as instructed. The purified DNA was isolated with specific immunoprecipitate or with negative control IgG and used as a template for PCR to amplify the HMGB1 promoter sequences. A 197-base pair fragment were amplified while using the ChIP primer sequences: 5′-CTCCAGGAAACGGCTTTGTA-3′ and 3′-TCCACAGAGTTAGTTCCAGAGGA-5′ corresponding to the core HMGB1 promoter.
6
TFEB ChIP-qPCR in Placental Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) of TFEB was performed in E-PE (N = 4) and PTC (N = 4) placentae and in JEG3 cells exposed to 20 μM CER 16:0 or control vehicle, using the EpiQuik Tissue ChIP Kit (EpiGentek, Farmingdale, NY, United States) according to the manufacturer’s instructions. Briefly, ∼50 mg of placental tissue was homogenized using a Dounce homogenizer and cross-linked. JEG3 cells were lysed and DNA was sheared by sonication prior to cross-linking. Samples were then incubated with 2 μg anti-goat ChIP-grade TFEB antibody per 25 μg chromatin to immunoprecipitate the protein-DNA complexes. Non-immune mouse IgG was used as a negative control, while RNA Polymerase II enrichment at the GAPDH promoter was used as positive control. Protein-DNA complexes were purified, and DNA was extracted. The purified DNA was quantified by qPCR using the Sybr Green® qPCR mastermix (Applied Biosystems (ABI), Foster City, CA, United States), employing primers targeting two distinct sites along the SMPD1 promoter (Table 2 depicts primer sequences).
7
ChIP-seq Protocol for Epigenetic Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were treated using the EpiQuik Tissue ChIP Kit (48 reactions) (P-2003-2, Epigentek, USA). Con uent cells at 70-80% con uency were xed with 1% formaldehyde at room temperature for 10 min to generate the intracellular DNA-protein crosslink, which was then randomly broken by ultra-sonication into fragments. Cell fragments were centrifuged at 13,000 g at 4℃, followed by the division of supernatant into three tubes, respectively, which was separately added with antibody RNA polymerase II (positive control), mouse antibody immunoglobulin G (IgG) (1 mg/mL) or rabbit IgG (3900, Cell Signaling Technology, USA) (negative control) or antibodies against KDM3A (ab91252, Abcam, Cambridge, UK), H3K27me3 (ab1220, Abcam, UK), CTGF (SimpleChIP Human CTGF Promoter Primers #14927, USA), H3K27ac (ab4729, Abcam) and H3K4me1 (ab8895, Abcam). After immunoprecipitation, de-crosslink was performed and proteins were treated by proteinase K. DNA was eluted and puri ed using Active Motif's ChIP DNA puri cation kit (58002, Millipore). Each experiment was repeated 3 times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!