Prime rt reagent kit

Manufactured by Vazyme

The Prime RT reagent kit is a product used for reverse transcription, which is the process of converting RNA into complementary DNA (cDNA). The kit contains the necessary reagents, including reverse transcriptase enzyme, to perform this reaction. The Prime RT reagent kit is designed to facilitate the conversion of RNA into cDNA, a crucial step in various molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green real time pcr kit, by Vazyme (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

RT Reagent Kit

2 protocols using prime rt reagent kit

Quantitative PCR Analysis of Autophagy Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction was accomplished by TRIzol reagent (Invitrogen) and the reverse transcription with Prime RT reagent kit (Vazyme). Quantitative PCR was performed utilizing SYBR Green real–time PCR kit (Vazyme). The relative mRNA levels were computed with the ΔCt method. PCR primer sequences are shown in Table 1.Table 1

Primer sequences of the targeted gene

Table 1

Primer	Sequence (5’ to 3’)
HIF1A_Fw	CACCACAGGACAGTACAGGAT
HIF1A_Rv	CGTGCTGAATAATACCACTCACA
Beclin–1_Fw	ACCTCAGCCGAAGACTGAAG
Beclin–1_Rv	AACAGCGTTTGTAGTTCTGACA
ATG5_Fw	TTGACGTTGGTAACTGACAAAGT
ATG5_Rv	TGTGATGTTCCAAGGAAGAGC
ATG7_Fw	GATCCGGGGATTTCTTTCACG
ATG7_Rv	CAGCAATGTAAGACCAGTCAAGT
ATG12_Fw	TAGAGCGAACACGAACCATCC
ATG12_Rv	CACTGCCAAAACACTCATAGAGA
β–Actin_Fw	TCACCCACACTGTGCCCA
β–Actin_Rv	ATGTCACGCACGATTTCCC

Wei J., Zhu K., Yang Z., Zhou Y., Xia Z., Ren J., Zhao Y., Wu G, & Liu C. (2023). Hypoxia-Induced Autophagy Is Involved in Radioresistance via HIF1A-Associated Beclin-1 in Glioblastoma Multiforme. Heliyon, 9(1), e12820.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA extraction was harvested by using TRIzol reagent (Invitrogen). Then the RNA extraction was undergoing reverse transcription by using Prime RT reagent kit (Vazyme). PCR primer sequences (5'to3') are recorded as follows: human Gapdh-F primer sequence CCACATCGCTCAGACACCAT; human Gapdh-R primer sequence TGACAAGCTTCCCGTTCTCA; human Linc00969-F primer sequence ACGGATCACCACTGCAAGAG; human Linc00969-R primer sequence TAGGTGGAATCGGGCCTGTA; human HUR-F primer sequence GAAGACCACATGGCCGAAGA; human HUR-R primer sequence TGGTCACAAAGCCAAACCCT. Quantitative PCR was performed by using SYBR Green real-time PCR kit (Vazyme).

Liu C., Lu C., Yixi L., Hong J., Dong F., Ruan S., Hu T, & Zhao X. (2023). Exosomal Linc00969 induces trastuzumab resistance in breast cancer by increasing HER-2 protein expression and mRNA stability by binding to HUR. Breast Cancer Research : BCR, 25, 124.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!