Protein quantitative analysis kit

Full-length Aly7A (including the N-terminal CBM and the C-terminal catalytic module), its derivative CBM (N-terminal catalytic module only; residues 39–156) and Aly7A-CD (C-terminal catalytic module only; residues 246–506) were generated by PCR and ligated into the T7 expression vector pET-21a (+) (Novagen, Darmstadt, Germany). The recombinant plasmids were separately transformed in E. coli BL21 (DE3) which were grown at 37 °C in LB medium supplemented with 100 µg mL⁻¹ ampicillin for 24 h. Enzyme was induced with 0.02 mM IPTG and incubation continued (20 °C, 20 h). Cells were centrifuged, resuspended in binding buffer and lysed by sonication at 4 °C. Binding and elution from a nickel nitrilotriacetic acid Sepharose (Ni-NTA Sepharose) column was performed according to the manufacturer’s instructions. Eluted proteins were subsequently analyzed by SDS-PAGE. A protein quantitative analysis kit was used for determination of protein concentrations (Beyotime Institute of Biotechnology, Nantong, China).

According to the genomic sequence information of Thalassotalea algicola, a pair of specific primers with Nde I and Xho I (TAPL7A-F: CGCCATATGTGCGCGAACACCGCGAACAC, TAPL7A-R: CCGCTCGAG TGAGCCGCCCGAGCAACAAC) was designed. The expression vector was pET-21a (+) plasmid and E. coli BL21 (DE3) was used as the expression host. The recombinant strain was incubated at 37 °C until OD600 was 0.4–0.6, and expression of the recombinant enzyme was induced at 22 °C for 36 h after the addition of 0.1 mM IPTG. Referring to the method of Singh et al., 8 M urea was used to dissolve the inclusion body proteins in the precipitate of the disrupted bacterial solution, and the renatured body proteins were obtained by dialysis [20 (link),48 (link)]. According to the method of zhu et al., the renatured TAPL7A was purified by a Ni-NTA Sepharose column (GE Healthcare, Uppsala, Sweden), and the TAPL7A before and after purification was verified by 12% (w/v) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) [49 (link)]. Protein concentration was determined by a protein quantitative analysis kit (Beyotime Institute of Biotechnology, Nantong, China).