Dig application manual for filter hybridization

Total RNA was extracted from infiltrated regions of the leaves using the guanidium thiocynate extraction method [45 ]. A measure of 30 μg of total RNA from each plant sample was resolved on a formamide agarose gel to check for GFP transcript and small RNA. The RNA was transferred on Hybond N⁺ membranes (Amersham Pharmacia, Peapack, NJ, USA). Digoxigenin-11-dUTP (DIG) labelled DNA probes were generated via PCR labelling using the PCR DIG Probe Synthesis kit (Roche, Basel, Switzerland, catalogue No. 11636090910). A measure of 10 ng of purified plasmid DNA containing the full length GFP DNA was used as the PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG) and reverse (GTGGTGGTGGCTAGCTTTGTA) primers. Northern blot analysis was performed at 50 °C using the protocol provided in the DIG Application Manual for Filter Hybridization (Roche). Following the hybridization, the blot was washed at 55 °C and probe detection was performed according to the manufacturers’ protocol using the DIG luminescent detection kit (Roche). The intensity of the individual bands was measured with respect to the background, and the integrated density value (IDV) was calculated using Alphaimager. Each experiment was performed in triplicates and the average values were used for plotting.

For northern blot analysis, total RNA was extracted from leaf tissues as described previously [37 (link)]. Total RNA (5 µg) was separated on 1% formaldehyde agarose gels, transferred to positively-charged nylon membranes (Roche Diagnostics, Mannheim, Germany), and probed with digoxigenin-labeled specific RNA probes for the RNA1 and RNA2 3′-untranslated region of TRV (6548–6789 nt of RNA1 and 1860–2101 nt of RNA2), and for the 3′-end region of PVX (5875–6403 nt of PVX cDNA sequence in pgR107 vector). For tissue blot hybridization, fresh cross-sections of four non-inoculated leaf petioles or stems were squash blotted on positively-charged nylon membranes (Roche Diagnostics, Mannheim, Germany), and blots were hybridized with the digoxigenin-labeled RNA probes mentioned above. The hybridization conditions used were those recommended by the manufacturer (DIG Application Manual for Filter Hybridization, Roche Diagnostics, Mannheim, Germany). Membranes were exposed to X-ray film (X-Omat AR, Kodak, Rochester, NY, USA) and developed following a conventional photographic process.

Southern blot and Northern blot analyses were performed mainly following the protocol described in “DIG Application Manual for Filter Hybridization” from Roche. Briefly, the RNA or intracellular core-associated HBV DNA extracted from Huh-7 cells were separated on a 1% agarose gel in 0.01 M Na⁺-phosphate buffer (pH 7.0 for Northern blot) or in 0.5X TAE buffer (20 mM Tris-base, 10 mM acetic acid, and 0.5 mM EDTA for Southern blot). The gel was blotted onto a positively charged nylon membrane (Cat: 11417240001, Roche), which was then hybridized with a digoxigenin (DIG)-labeled probe encompassing the HBx coding region (nt 1372–1833) that was generated using the DIG PCR Probe Synthesis kit (Cat: 1636090910, Roche). After 16 h of hybridization at 45°C (Southern blot) or 52°C (Northern blot), the membrane was washed following the instructions and blocked with 1X DIG blocking buffer (Cat: 11096176001, Roche) for 30 min and then incubated with alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:10,000 dilution, Cat: 11093274910, Roche). The signals were detected by chemiluminescence using the CDP-Star substrate (Cat: 2041677, Roche).

RNA (5 μg) from the LS174T cell line, a colorectal adenocarcinoma sample and a normal colonic mucosa sample were subjected to agarose gel (1.2%) electrophoresis using MOPS electrophoresis buffer and 2% formaldehyde in the gel, according to the “DIG Application Manual for Filter Hybridization” (Roche). A digoxigenin (DIG)-labeled RNA size standard was analyzed in parallel. RNA was blotted onto a positively charged nylon membrane by capillary transfer and hybridized to 2.5 pmol of four PHGR1-specific DIG-labeled DNA hybridization probes, according to the same DIG application manual. The sequences of the hybridization probes were: 5′-GGA GTA AGA GCA GGG AAT ACC TGA GAG TGC AGA GCA GGG GCA GGA AGT C-3′, 5’-GCC CGC AGT GAC CTG GAG GAT GGC CAT GCC CCC CAC AGT G-3′, 5’-GGC CCT GGA CCA TGG TGG GGG GGT GGC CCG CAG G-3′ and 5’-GGC CTC ATT CCA GGT CAG CTG GGC AAT TCT CTC AGG CTT GCC-3′. The hybridization signals were detected by an alkaline phosphatase-conjugated DIG antibody according to the application manual.

Southern blotting was conducted by using Dig Application Manual for Filter Hybridization (Roche, Basel, Switzerland). H. brasiliensis genomic DNA was extracted from the leaves of rubber tree and digested with BamH I, EcoR I, Hind III, and Xba I (Thermo Scientific, Guangzhou, China). Ten μg of each digestion product was electrophoresed on a 0.8% agarose gel at 1 V/cm overnight, and then transferred onto a positively charged nylon membrane (Roche, Basel, Switzerland) through capillary transfer by 20× SSC (saline sodium citrate) for about 12 h. UV (ultraviolet) crosslink of the DNA to the filter was at a strength of 90,000 μJ/m². The cross-linked filters were hybridized with ~350 bp Dig PCR labeled probes of each REF and SRPP genes, respectively. The primers for the probes are listed in Table S2. Hybridization was performed at 42 °C and the probes were washed at a low stringent condition. DNA blots were visualized by LAS4000mini (GE Healthcare, Uppsala, Sweden).