The pcDNA3 14-3-3ζ plasmid (ID: 9002) was obtained from Addgene (Cambridge, MA, American). The PLKo-sh14-3-3ζ plasmid was obtained by cloning14-3-3ζ-small hairpin RNA into the pLKO vector (Invitrogen, St. Louis, MO, USA). All of the constructs were confirmed using DNA sequencing and western blot analyses. Transfections were performed using the Lipofectamine 2000 Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's recommended instructions. Stable 14-3-3ζ and sh14-3-3ζ expression was established in hepatoma cells using Geneticin (G418) (Sigma, USA) selection.
Plko vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
PLKO vectors are a type of plasmid DNA that can be used for gene expression and knockdown studies in mammalian cells. These vectors contain a polIII promoter and a multiple cloning site, allowing for the insertion of desired genetic sequences. PLKO vectors can be used for the generation of stable cell lines through the inclusion of a selectable marker.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000 kit, by Thermo Fisher Scientific (1 mentions)
Geneticin g418, by Merck Group (1 mentions)
Lipofectamine plus, by Thermo Fisher Scientific (1 mentions)
Epr3724, by Abcam (1 mentions)
Tet plko puro plasmid, by Addgene (1 mentions)
Mission plko 1 puro non target shrna control plasmid dna, by Merck Group (1 mentions)
In fusion cloning, by Takara Bio (1 mentions)
Gsk j4, by Merck Group (1 mentions)
8 protocols using plko vector
1
Stable Transfection of 14-3-3ζ Plasmids
2
Knockdown of 14-3-3ζ using shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA-14-3-3ζ plasmids (#1, 2, and 3 nucleotides) or the controls were purchased from Santa Cruz Biotechnology. The three sequences for 14-3-3ζ were selected:
5′-GCCUGCAUGAAGUCUGUAATTUUACAGACUUCAUGCAGGCTT-3′,
5′-CGUCUCAAGUAUUGAACAATTUUGUUCAAUACUUGAGACGTT-3′ and
5′-CACGCUAAUAAUGCAAUUATTUAAUUGCAUUAUUAGCGUGTT-3′. PLKO vector (Invitrogen, St. Louis, MO, USA) was used. Infected cells were selected by puromycin (1.25 ug/ml).
5′-GCCUGCAUGAAGUCUGUAATTUUACAGACUUCAUGCAGGCTT-3′,
5′-CGUCUCAAGUAUUGAACAATTUUGUUCAAUACUUGAGACGTT-3′ and
5′-CACGCUAAUAAUGCAAUUATTUAAUUGCAUUAUUAGCGUGTT-3′. PLKO vector (Invitrogen, St. Louis, MO, USA) was used. Infected cells were selected by puromycin (1.25 ug/ml).
3
Silencing LRP1 in SH-SY5Y Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral shRNA constructs targeted against human LRP1 (TRCN0000053253) and a control shRNA in the pLKO vector (Thermo Scientific) were transfected into human embryonic kidney 293T cells using Lipofectamine-Plus (Invitrogen). At 24 and 48 h post-transfection, culture media from transfected dishes were pooled and pelleted by centrifugation at 100,000g for 1.5 h. The lentiviral pellet was resuspended in sterile PBS and used to infect cultured SH-SY5Y cells with polybrene (4 μg/ml). Infection was repeated at 48 and 72 h after the initial addition. Knockdown efficiency was evaluated using anti-LRP1 immunoblotting (catalog no.: EPR3724; Abcam).
4
Inducible Knockdown of Pim-2 and FLT3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Tet-pLKO-puro plasmid (49 (link)) (Addgene plasmid 21915) was used to express hairpins targeting Pim-2 or FLT3 in a Dox-dependent manner after lentiviral delivery. The sequences were 5′-GATGAACCCTACACTGACTTT-3′ (Pim-2) and 5′-GCATCCCAGTCAATCAGCTTT-3′ (FLT3). Scrambled and Pim-2 hairpins expressed in a noninducible pLKO vector were purchased from Thermo Scientific.
5
Megalin Mini Receptor Plasmid Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Megalin mini receptor (mMeg) was generated from a human kidney cDNA library (Marzolo et al., 2003 (link); Farfán et al., 2013 (link)). Plasmids for phosphomimetic mMeg (mMeg S170D), non-phosphorylatable mMeg (mMeg S170A) and mMeg lacking the ectodomain (Meg0) were described previously (Yuseff et al., 2007 (link); Marzolo and Farfán, 2011 (link)). mCherry-Rab11 was kindly provided by Dr. Alexis Gautreau (Derivery et al., 2009 (link)). Human OCRL1-EGFP was described before (Vicinanza et al., 2011 (link)). Plasmids for short hairpin RNAs were MISSION® pLKO.1-puro Non-Target shRNA Control Plasmid DNA (Sigma-Aldrich), pLKO vectors purchased from Open Biosystems (shOCRL1 5′- GCCAAGTATAAGAAAGTTCAA -3′ and shAPPL1 5′- GCATTGTTAGAACCTCTACTT-3′). The primers used in quantitative PCR reactions were as follows: megalin forward, 5′- CTGCTCTTGTAGACCTGGGTTC -' 3; megalin reverse, 5′- TCGGCACAGCTACACTCATAAC -3; glyceraldehyde-3-phosphate dehydrogenase forward, 5′- TCAAGGCTGAGAATGGGAAG -`3; glyceraldehyde-3-phosphate dehydrogenase reverse, 5′- AGCAGAAGGGGCAGAGATG -`3.
6
Lentiviral Transduction of CD34+ Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-VSV-G and pCMV-HIV1 were provided by Dr John Rossi (Beckman Institute of City of Hope, Duarte, CA). The pLKO-GFP came from Professor Kamil Kranc (University of Edinburgh). The following optimized pLKO vectors were purchased from Open Biosystems and sub cloned into the pLKO-GFP vector:
Transduced viable cells (assessed as AnnexinV-/DAPI− percentages multiplied by the absolute cell count) are presented as a percentage of CML CD34+ cells transduced with scramble control.
TRCN0000003380: MDM2 shRNA bacterial stock NM_002392.x-1495s1c151 (link)
TRCN0000355728: MDM2 shRNA bacterial stock NM_002392.3-1496s21c1
TRCN0000174055: c-Myc shRNA bacterial stock NM_002467.2-1377s1c252 (link)
TRCN0000039642: c-Myc shRNA bacterial stock NM_002467.2-1377s1c153 (link)
Transduced viable cells (assessed as AnnexinV-/DAPI− percentages multiplied by the absolute cell count) are presented as a percentage of CML CD34+ cells transduced with scramble control.
7
Lentiviral Transduction of CD34+ Cells
8
Wdr5 Knockdown in Pancreatic Islets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three different pLKO vectors containing short hairpin constructs targeting Wdr5 under control of the hU6 promoter, and a scramble shRNA construct, were purchased from OpenBiosystems. These shWdr5 expressing vectors were prescreened for their ability to suppress Wdr5 in MIN6 cells. Subsequently, the optimal targeting sequence that suppressed Wdr5 by ~90%, and the scramble sequence, were inserted into pAdTrack using InFusion cloning (Clontech) and sequence verified. These were then used to make the pAdV-shWdr5 and pAdV-shScramble adenoviruses using the pAdEasy system as previously described [69 (link)]. Islets were transduced with these adenoviruses at the indicated MOI’s for three hours and 48 hours later were treated with or without IFNγ, Il-1β and TNFα, as indicated, for a subsequent three hours. GSK-J4 (Sigma-Aldrich) or DMSO was used to treat islets at the concentrations indicated with or without IFNγ, Il-1β and TNFα for three hours.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!