Dneasy kit

Genomic DNA was extracted from both WT and transgenic algae using the DNeasy kit (Takara, Japan). PCR was performed according to the standard protocols [44 ] to verify the presence of amiRNA-D1 on transgenic alga. PCR was performed using the primer pair D1g-F (5′-TGACCTCCACTTTCAGCGACA-3′) and D1g-R (5′-ACTTGAGAGCAGTATCTTCCATCCA-3′), which resulted in an amplicon of about 600 bp. PCR conditions were incubated at 94 °C for 5 min, followed by 25 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, plus a final extension for 7 min. All the amplified products were purified and verified by sequencing analyses (Sangon Biotech., Shanghai, China).

No live animals were used in this study. Genomic DNA was extracted from tissue of an XY individual of M. minutoides or M. mattheyi (specimens collected under permits 2003/PFHG/05/GUI, 1155 MDCS/CAB-1/kss14 (link)) using a Qiagen DNeasy kit and subject to PCR amplification (Takara LA PCR kit) with primers designed based on M. musculus sequence. Primer sequences are provided in Supplementary Table S1. Eight (for Sry), four (for TESCO), or three (for each Sf1 coding exon) independent clones from each PCR product were sequenced. Sequences were aligned using ClustalW61 (link). Identity scores were calculated using GeneStream II62 (link).

PCR analysis was utilized to confirm the successful transformation of our target amicroRNA-PEPC1/2. Genomic DNA was extracted from both WT and transgenic algae using the DNeasy kit (Takara, Japan). PCR was carried out according to the standard protocols to verify the presence of amicroRNA-PEPC1/2 on transgenic alga. PCR was performed using the primer pair pH124-F (5′TGACCTCCACTTTCAGCGACA3′) and pH124-R (5′ACTTGAGAGCAGTATCTTCCATCCA3′), which resulted in an amplicon of about 675 bp. PCR conditions were as follows: incubation at 95 °C for 2 min, followed by 25 cycles of 95 °C for 30 s, 60 °C for 15 s, and 72 °C for 15 s, plus a final extension for 7 min. All the amplified products were purified and verified by sequencing analyses (Sangon Biotech., Shanghai, China).