Genomic DNA was extracted using a NucleoSpin Tissue kit (Macherey-Nagel GmbH & Co. KG, Dueren, Germany) and treated with sodium bisulfite using an EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA). During the modification, unmethylated cytosines of the genomic DNA are converted to uracils, while methylated cytosines remained unchanged. The bisulfite-modified DNA subjected to PCR using primer pairs that specifically amplify either methylated or unmethylated sequences of BTG1. The following methylated BTG1-specific primers were used 24 (link): MSP1 (-149 to -289), 5′-GTT TTT AAG TTA AAA GGA AGG AAG TC-3′ (sense) and 5′-ATA TCA AAA AAT ATT AAA AAT CAC GCA-3′ (antisense); MSP2 (-517 to -645), 5′-TTT GAG GAG TTA GTT ATC GAG ATT C-3′ (sense) and 5′-AAA TAA ATA AAA ACC GCC TAA CG-3′ (antisense). The following unmethylated BTG1-specific primers were used: USP1 (-149 to -289), 5′-GTT TTT AAG TTA AAA GGA AGG AAG TTG T-3′ (sense) and 5′-ATA TCA AAA ATA TTA AAA ATC ACA CA-3′ (antisense); USP2 (-517 to -645), 5′-TGA GGA GTT AGT TAT TGA GAT TTG G-3′ (sense) and 5′-AAA TAA ATA AAA ACC ACC TAA CAC A-3′ (antisense). MSP was performed in 20-μL mixtures for 40 cycles using hot-start polymerase (Qiagen, Hilden, Germany).
Hot start polymerase
Manufactured by Qiagen
Sourced in Germany
Hot Start polymerase is a thermostable DNA polymerase enzyme designed for use in PCR (Polymerase Chain Reaction) techniques. It remains inactive at lower temperatures, preventing non-specific amplification, and becomes activated at higher temperatures, enabling specific target DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Ampflstr identifiler pcr amplification kit, by Thermo Fisher Scientific (3 mentions)
Ln229, by American Type Culture Collection (3 mentions)
Mycoplasma primer sets, by Qiagen (2 mentions)
Du145, by American Type Culture Collection (2 mentions)
Ez dna methylation kit, by Zymo Research (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Mcf 10a, by American Type Culture Collection (1 mentions)
Ovcar8, by American Type Culture Collection (1 mentions)
Lncap, by American Type Culture Collection (1 mentions)
Rwpe 1, by American Type Culture Collection (1 mentions)
Mcf 7, by American Type Culture Collection (1 mentions)
H1299, by American Type Culture Collection (1 mentions)
Nih3t3, by American Type Culture Collection (1 mentions)
Mda 231, by American Type Culture Collection (1 mentions)
Rox reference dye, by Thermo Fisher Scientific (1 mentions)
Syto9, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Thermal cycler, by Bio-Rad (1 mentions)
8 protocols using hot start polymerase
1
Methylation-specific PCR analysis of BTG1
2
Cell Line Authentication and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prostate adenocarcinoma PC3 and DU145, neuroblastoma SKN, glioblastoma LN229, ovarian cancer OVCAR8, breast epithelial MCF10A, and cervical carcinoma HeLa cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA) and maintained in culture according to the supplier’s specifications. MEFs were prepared from WT or Parkin KO mice. Cell passaging was limited to <40 passages from receipt, and cell lines were authenticated by STR (Short Tandem Repeat) profiling with AmpFLSTR Identifiler PCR Amplification Kit (Life Technologies) at the Wistar Institute’s Genomics facility. Mycoplasma-free cultures were confirmed at the beginning of the studies and every 2 months afterward by direct polymerase chain reaction (PCR) of cultures using Bioo Scientific Mycoplasma Primer Sets (catalog no. 375501) and Hot Start polymerase (QIAGEN). Conditioned medium was prepared from exponentially growing cultures of NIH3T3 cells (ATCC) maintained in Dulbecco’s modified Eagle’s medium supplemented with d -glucose (4.5 g/liter), sodium pyruvate, 10 mM Hepes, and 10% fetal bovine serum for 48 hours.
3
Illumina DNA Fragment Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Illumina sequencing, fragments were attained by PCR amplification of the restriction digested and adaptor ligated genomic DNA samples. 1 μL of digested and adaptor ligated DNA and 6 μL of 10 μM amplification primer PmeI_CG17 (5′-CACGACTGTTTAAACGG-3′) were used in a 50 μL PCR reaction containing 2.5 U HotStart Polymerase (Qiagen), 1 μL 25 mM MgCl2, and 1 μL 20 μM dNTPs. The PCR yielded 200–800 bp fragments under the following cycling conditions: 95°C for 15 minutes; 30 times 95°C/30 sec, 55°C/40 sec, 72°C/50 sec; 72°C for 5 minutes. The PCR reactions were precipitated in EtOH and DNA dissolved in 100 μL 5 mM Tris buffer (pH 8.0). Eight parallel reactions were performed for each restriction enzyme setup in order to collect sufficient amount of DNA for subsequent sequencing.
4
Cell Line Authentication and Mycoplasma Testing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human prostate adenocarcinoma (LNCaP, C4-2, C4-2B, PC3 and DU145), normal prostatic epithelial (RWPE-1) and human glioblastoma (LN229) cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA), and maintained in culture according to the supplier's specifications. Benign prostatic hyperplasia (BPH-1) cells were a gift from Dr. Simon Hayward (Vanderbilt University, Nashville, TN) and primary human foreskin fibroblasts (HFF) were a gift from Dr. Meenhard Herlyn (The Wistar Institute, Philadelphia, PA). Neuroblastoma SHEP21N, SHEP21-NMycER cells containing a conditionally-regulated N-Myc transgene were as described [30 (link)] and used in recent studies of mitochondrial reprogramming in cancer [29 ]. In these cells, treatment with 50 ng/ml doxycycline (Dox) for 48 h suppresses N-Myc expression, whereas addition of 4-hydroxytamoxifen (4OHT, 0.5 μg/ml) results in strong N-Myc induction. Cell passaging was limited to <40 passages from receipt and cell lines were authenticated by STR profiling with AmpFlSTR Identifiler PCR Amplification Kit (Life Technologies) at the Wistar Institute's Genomics Shared Resource. Mycoplasma free-cultures were confirmed at the beginning of the studies, and every 2 months afterwards, by direct PCR amplification using Bioo Scientific Mycoplasma Primer Sets (cat. #375501) and Hot Start polymerase (QIAGEN).
5
Cell Line Authentication and Mycoplasma Screening
6
KRAS Mutation Detection in DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extracted from tissue and plasma samples was subjected to an allele refractory mutation system qPCR (ARMS-qPCR) for detection of six of the most common mutations in codons 12 and 13 of the KRAS gene (G12A, G12D, G12V, G12S, G12C, and G13A). DNA was amplified in a 25 μl reaction mixture containing 0.25 μM of each amplification primer, 200 μM of each dNTP (GE Healthcare, Little Chalfont, UK), 1× HotStart Buffer (Qiagen, Hilden, Germany), 2 mM MgCl2, 2 units HotStart polymerase (Qiagen, Hilden, Germany), 2 μM SYTO 9 (Invitrogen, Life Technologies, Carlsbad, CA), 1×ROX reference dye (Invitrogen) and 25 ng DNA. The primer sequences have been previously described elsewhere [10 (link)], with the exception of the common reverse primer which has been re-designed in order to shorten the amplicons of both codon 12 (90 bp) and codon 13 (85 bp) (originally of 149 and 144 bp in length). The resulting sequence was as follows: TGTTGGATCATATTCGTCCACA .
The PCR amplification was performed with precycling heat activation of DNA polymerase at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 64°C for 30 sec and extension at 72°C for 30 sec, in a ABI Prism 7500 Sequence Detection System (Applied Biosystems—Foster City, CA, USA). The PCR product of mutated samples was run on 2% agarose gel to confirm the presence of the specific bands.
The PCR amplification was performed with precycling heat activation of DNA polymerase at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 64°C for 30 sec and extension at 72°C for 30 sec, in a ABI Prism 7500 Sequence Detection System (Applied Biosystems—Foster City, CA, USA). The PCR product of mutated samples was run on 2% agarose gel to confirm the presence of the specific bands.
7
Prostate Cancer Cell Culture Protocols
8
Integrin subunit expression analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!