The largest database of trusted experimental protocols

Si e2f3

Manufactured by GenePharma
Sourced in China

Si-E2F3 is a laboratory equipment product designed for genomic research. It is a tool used for the analysis and manipulation of the E2F3 gene, which is known to play a role in cell cycle regulation and proliferation. The core function of Si-E2F3 is to facilitate the study and investigation of the E2F3 gene and its associated cellular processes, without making any claims about its intended use or applications.

Automatically generated - may contain errors

6 protocols using si e2f3

1

Knockdown of Brachyury and E2F3 in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-7 and MDA-MB-231 (human breast cancer cell lines) were obtained from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained in Dulbecco's modified Eagle medium (DMEM, Thermo Fisher) supplemented with 10% fetal bovine serum (Gibco, New Zealand) and 1% penicillin/streptomycin (Invitrogen) and cultured at 37°C in a humidified incubator containing 5% CO2.
The interfering RNA (siRNA) sequences targeting Brachyury: (si-Brachyury#1)-5′-GCUGAACUCCUUGCAUAAG-3′; (si-Brachyury#2)-5′-GCUUAUCAGAACGAGGAGA-3′; the siRNA sequences targeting E2F3: (si-E2F3#1)-5′-GCGGUAUGAUACGUCUCUU-3′; (si-E2F3#2)-5′-GCAUCCACCUCAUUAAGAA-3′; the positive control siRNA: (si-GAPDH)-5′-UGACCUCAACUACAUGGUU-3′ and the negative control siRNA (si-NC)-5′-UUCUCCGAACGUGUCACGU-3′ were purchased from GenePharma (Shanghai, China). Brachyury, E2F3, and the negative control siRNAs were transfected into MCF-7 and MDA-MB-231 cells with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. Sh-Brachyury and empty vector (GenePharma) were stably transfected into MDA-MB-231 cells. Cells were harvested for analysis at 48 h post-transfection.
+ Open protocol
+ Expand
2

Modulation of E2F3 in Podocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-770-5p mimic (miR-770-5p), miR-770-5p inhibitor (anti-miR-770-5p), siRNA
against E2F3 (si-E2F3), and negative controls (miR-NC, anti-miR-NC, si-NC) were
obtained from GenePharma (China). For overexpression of E2F3, the cDNA sequence
of E2F3 was inserted into pcDNA3.1 empty vector (Invitrogen), termed as
pcDNA3.1-E2F3 (E2F3). All oligonucleotides and plasmids were transfected into
podocytes (2×105 cells/well) with Lipofectamine 2000 reagents
(Invitrogen), according to the operation manual.
+ Open protocol
+ Expand
3

Overexpression and Silencing of TUG1 in Podocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
To over-express TUG1, the cDNA sequences of TUG1 were cloned in pcDNA3.1 empty vector (pcDNA; Invitrogen), termed as pcDNA3.1-TUG1 (TUG1). siRNA against TUG1(si-TUG1), siRNA against E2F3 (si-E2F3) and corresponding scrambled negative control (si-NC), miR-27a-3p mimic (miR-27a-3p), miR-27a-3p inhibitor (in-miR-27a-3p), and scrambled negative controls (miR-NC, in-miR-NC) were purchased from GenePharma (Shanghai, China). Transient transfection of the indicated oligonucleotides and plasmids into treated podocytes was implemented by Lipofectamine 2000 reagents (Invitrogen) based on the operation manual.
+ Open protocol
+ Expand
4

miR-152-3p Modulation in Colorectal Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
An miR‐152‐3p mimic (forward [F], 5′‐UCAGUGCAACUGACAGAACUUGG‐3′; reverse [R], 5′‐UAGCCACGGUUGUGUAAAGUCUG‐3′), an miR‐152‐3p inhibitor (F, 5′‐CGCGCUAGCAGCACGUAAAU‐3′; R, 5‐GUGCAGGGUCCGAGGUCAUC‐3′), and their negative controls (F, 5′‐CAGUACUUUUGUGUAGUACAA‐3′; R, 5′‐CAGUACUUUUGUGUAGUACAA‐3′), as well as a si‐E2F3 (GCTTCCAAAGACTTGGCTT) were obtained from GenePharma. The pSilencer (shPVT1‐1, 5′‐GCUUGGAGGCUGAGGAGUUTT‐3′; shPVT1‐2, 5′‐CCCAACAGGAGGACAGCUUTT‐3′) and pcDNA3.1 plasmids for silencing or overexpressing PVT1 were obtained from General Biocompany. The antagomir‐152‐3p was purchased from RiboBio. Colorectal cancer cells were seeded into a 24‐well plate. Twenty‐four hours later, the cells were transfected with mimic, inhibitor, negative controls, or specific plasmids for 48 hours using Lipofectamine 2000 following the manufacturer’s instructions.
+ Open protocol
+ Expand
5

Hepatoma and Kidney Cell Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 and Hep3B human hepatoma cells, and 293 human embryonic kidney cells were obtained from the Key Laboratory of Environment and Genes Related to Diseases at Xi'an Jiaotong University. The cells were cultured in Dulbecco's Modified Eagle's Medium (Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2 in a humidified atmosphere. HepG2 cells were authenticated by short tandem repeat analysis. miR-15a-5p mimic, mimic control, si-E2F3 and si-control were synthesized by Shanghai GenePharma Co., Ltd. miR-15a-5p-inhibitor and inhibitor-ctrl were synthesized by Sangon Biotech Co., Ltd. Cells were transfected with miR-15a-5p mimic (50 nM), mimic-ctrl (50 nM), miR-15a-5p inhibitor (1 µg/ml), inhibitor-control (1 µg/ml), si-E2F3 or si-control (50 nM) by using JetPrime transfection reagent (Polyplus-transfection SA) according to the manufacturer's instructions. The sequences are presented in Table SI.
+ Open protocol
+ Expand
6

SNHG22 and E2F3 Modulation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNAs (siRNAs) against SNHG22 (sh#1, sh#2) or E2F3 (siE2F3), as well as overexpression vectors, pcDNA3.1/Control (Vector), pcDNA3.1/SNHG22 (SNHG22), and pcDNA3.1/E2F3 (E2F3), were purchased from Gene Pharma (Shanghai, China). Plasmid with a non-targeting sequence was used as a negative control (siNC). The microRNA mimics, inhibitor, and negative control (NC mimic and NC inhibitor) were purchased from Ribio (Guangzhou, China). In vivo experiments, vectors containing short hairpin RNAs (shRNA) targeting SNHG22 (shSNHG22), sh#1, and sh#2 were subcloned into Lv5 lentiviruses (GenePharma, Shanghai, China) and infection into LoVo cells to generate Lv-sh#1 and Lvsh#2. Before transfection, the cells were cultured for 24 h. Then, the cells were transiently transfected with the corresponding vector using Lipofectamine 3000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!