Sequalprep normalization plate kit

The V4 region of the 16S rRNA gene was amplified in triplicate as previously described (Fujimura et al, 2016). Triplicate reactions were combined and purified using the SequalPrep Normalization Plate Kit (Invitrogen) according to manufacturer’s specifications. Purified amplicons were quantitated using the Qubit dsDNA HS Assay Kit and pooled at equimolar concentrations. The amplicon library was concentrated using the Agencourt AMPure XP system (Beckman-Coulter) quantitated using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to 2nM. Equimolar PhiX was added at 40% final volume to the amplicon library and sequenced on the Illumina NextSeq 500 Platform on a 153bp x 153bp sequencing run.

Barcoded primers Bact-515F (5′-GTGCCAGCMGCNGCGC-3′) and Bact-1061R (5′-CRRCACGAGCTGACGAC-3′) described by Klindworth et al. (2013) [46 (link)] were used for the initial amplification of the V4-V6 region of the 16S rRNA gene as previously described [3 (link)]. PCR reactions contained 2.5 U of Taq DNA Polymerase (Invitrogen, Cergy Pontoise, France), 5 µL of 5X buffer, 75 nmol MgCl₂, 1 µL of 10 mM dNTPs, 1 µL of each primer (50 µM) and 50 ng of DNA. Three PCR reactions were run for each sample as follows: 95 °C for 5 min, followed by 40 cycles at 95 °C for 45 s, 60 °C for 45 s, 72 °C for 45 s and a final extension at 72 °C for 5 min. PCR reactions from the same sample were pooled, purified using the QIAquick PCR purification kit (Qiagen, Courtaboeuf, France) and quantified using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) using the dsDNA HS Assay Kit (Life Technologies). To ensure equal representation of each sample in the sequencing run, each barcoded sample was standardized by calculating equimolar amounts (100 ng/sample) using the SequalPrep Normalization Plate Kit (Invitrogen) prior to pooling. Pooled samples of the 16S rRNA gene multiplexed amplicons were sequenced on a Roche 454 Genome Sequencer FLX Titanium instrument using the GS FLX Titanium XLR70 sequencing reagents and protocols (Beckman Coulter Genomics, Danvers, MA, USA).

Colonic feces were collected from mice after euthanasia and were lysed using bead beating with the QIAGEN TissueLyser II. Genomic DNA was extracted using the QIAGEN Powersoil kit.
Amplicons in the V4 hypervariable region of 16S rRNA genes were amplified with MyTaq polymerase master mix (Bioline). In this step, amplicons of each sample were differently barcoded with primers 515F/806R (Kozich et al., 2013 (link)). ZymoBIOMICS (Zymo) positive controls and extraction and PCR negative controls were run alongside the samples. PCR products were run on 1.2% TAE agarose gels to verify reaction success. Amplicons were cleaned and normalized with the SequalPrep Normalization Plate Kit (Invitrogen). Samples were pooled and cleaned with 1X Ampure XP Beads (Beckman Coulter). Sequencing was performed on an Illumina MiSeq with 2 × 250 bp reads. Sequences were processed with mothur and aligned to the SILVA database release 123 and taxonomically classified with the Ribosomal Database Project classifier 11 (Pruesse et al., 2007 (link); Cole et al., 2009 (link)). Non-bacterial sequences and chimeric sequences detected by UCHIME were removed. Operational Taxonomic Unit (OTU) clustering was performed with VSEARCH, using abundance-based greedy clustering (Rognes et al., 2016 (link)).

DNA extraction and library preparation were performed as described previously [16 (link)]. Briefly, mock communities were ordered as extracted DNA standards (Zymo Research, cat. no. D6311), and a peat soil sample was extracted using a phenol-chloroform extraction method after mechanical lysis (bead-beating) [17 (link)]. The V3-V4 or V4 regions of 16S rRNA genes were amplified (30 cycles) using primers 341F and 785R [15 (link)] or 515F and 806R [18 (link)], respectively, modified with a linker sequence [16 (link)] and barcoded (8 cycles) in a CD or unique dual (UD) setup. The barcoded samples were purified and normalized over a SequalPrep™ Normalization Plate Kit (Invitrogen) using a Biomek^® NXP Span-8 pipetting robot (Beckman Coulter), pooled and concentrated on columns (Anlaytik Jena). Sequencing libraries were prepared with the Illumina TruSeq Nano Kit and sequenced in paired-end mode (2 × 300 nt; v3 chemistry) on an Illumina MiSeq following the manufacturer’s instructions. The workflow systematically included four negative controls (PCR blanks, i.e., PCR-grade water as template) for each 90 samples sequenced.

For nucleic acids extraction, we used 100 mg of stool or 500 ul swab solution for skin and oral samples, after vigorous vortexing to release cells from the swab. Nucleic acids were extracted using a phenol-chloroform bead beating protocol (Griffiths et al., 2000 (link)). Barcoded amplicon libraries were prepared according to a two-step PCR protocol as described previously (Herbold et al., 2015 (link)). Briefly, the extracted DNA was PCR amplified for 30 cycles in total, using a universal primer pair S-D-Bact-0341-b-S-17 [5′-CCTACGGGNGGCWGCAG-3′] and S-D-Bact-0785-a-A-21 [5′-GACTACHVGGGTATCTAATCC-3′] that targets the V3-V4 hypervariable regions of the 16S rRNA gene. Amplicon libraries were purified and normalized in equal molar quantities with the SequalPrep™ Normalization Plate Kit (Invitrogen, United States) before pooling. The preparation was performed on an automated liquid handling workstation (Beckman Coulter, United States). Sequencing on the Illumina MiSeq platform (2 × 300bp) was performed at Microsynth AG (Balgach, Switzerland).

PCR amplification of the 16S rRNA gene and sequencing was performed using a process described previously [15 ,16 ]. Briefly, the V3V4 region of the 16S rRNA gene was amplified using 319F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) universal primers barcoded for each sample that also included a linker sequence required for Illumina HiSeq 300 bp paired-ends sequencing, and a 12-bp heterogeneity spacer index sequence aimed at minimizing biases associated with low-diversity amplicon sequencing [15 ,16 ]. 50 ng of template DNA was added with Phusion High-Fidelity DNA polymerase (Thermo Fisher, USA) in a total volume of 25μl master mix along with an additional 0.375μl of Bovine Serum Albumin (BSA) (20 mg/ml, Sigma, MO, USA) as previously described [15 ,16 ]. PCR reactions using template DNA and negative controls were run under thermocycler parameters described previously [15 ]. Amplicons were pooled (25ng of 16S PCR amplicon from each sample) using the SequalPrep Normalization Plate Kit (Invitrogen Inc., CA, USA), and sequenced on the Illumina HiSeq (Illumina, San Diego, CA).

The two hypervariable regions V1 and V2 of the 16S rRNA gene were amplified using the forward 27F primer and reverse 338R primers and dual MID indexing, as described by Kozich et al. [56 (link)]. Bacterial DNA was dually barcoded by unique forward and reverse primers, as described by Caporaso et al. [57 (link)], enabling subsequent multiplexing of the PCR product. PCR products were evaluated by gel analysis and normalized using the SequalPrep Normalization plate Kit (Invitrogen), according to manufacturer’s instructions. The pooled PCR products were measured fluorometrically using Qubit 4 Fluorometer (Invitrogen), to test DNA concentration.