Patient PBMCs were lysed in RIPA buffer supplemented with cOmplete™ Protease Inhibitor Cocktail (Roche) and PhosSTOP (Roche) on ice. Protein concentration was determined using DC protein assay (Bio-Rad Laboratories) and samples prepared in 1x NuPage loading buffer (Invitrogen™) with 1x NuPage Sample Reducing Agent (Invitrogen™). Samples were run on NuPage Bis-Tris 4-12% (Invitrogen™) and NuPage Tris-Acetate 3–8% (Invitrogen™) gels and transferred using iBlot dry transfer system (Invitrogen™). Membranes were blocked 1h at RT using 5% bovine serum albumin or milk in PBSt 0.1% Tween-20 and primary antibody incubated over-night at 4°C, ENO1 (Abcam, #ab155102), ENO3 (Abcam, #ab126259), HIF-1α (BdBioscience, #610959), Akt (Abcam, #ab2771), Akt(S473) (Abcam, #ab81283), mTOR (Abcam, #ab32028), mTOR(S2448) (Abcam, #ab109268), S6K1 (Abcam, #ab32529), S6K1(T389 + T412) (Abcam, #ab60948), 4EBP1 (Abcam, #ab32024), 4EBP1(T37) (Abcam, #ab75767), or β-Actin (Sigma-Aldrich, #A5441). The secondary antibody (Dako, Aglient) was incubated 1h at RT prior detection using Amersham ECL/ECL select (GE Healthcare). Relative protein quantification was analysed using ImageLab version 6.0.1 (Bio-Rad Laboratories), results analysed using Mann-Whitney U-test or unpaired t-test and visualized using Prism 8.4.3 (GraphPad Software) (significance level, p<0.05).
Ab32024
Manufactured by Abcam
Sourced in China, United States, United Kingdom
Ab32024 is a laboratory equipment product. It is designed for a core function, but no further details are provided to maintain an unbiased and factual approach.
Automatically generated - may contain errors
Lab products found in correlation
Ab109268, by Abcam (4 mentions)
Ab32028, by Abcam (3 mentions)
Ab81283, by Abcam (3 mentions)
Ab205719, by Abcam (2 mentions)
Ab32359, by Abcam (2 mentions)
Ab155102, by Abcam (1 mentions)
Ab2771, by Abcam (1 mentions)
Ab32529, by Abcam (1 mentions)
Ab60948, by Abcam (1 mentions)
Nupage sample reducing agent, by Thermo Fisher Scientific (1 mentions)
Nupage 4 12 bis tris, by Thermo Fisher Scientific (1 mentions)
Nupage tris acetate 3 8, by Thermo Fisher Scientific (1 mentions)
Iblot dry transfer system, by Thermo Fisher Scientific (1 mentions)
Image lab version 6, by Bio-Rad (1 mentions)
Prism 8, by GraphPad (1 mentions)
Nupage loading buffer, by Thermo Fisher Scientific (1 mentions)
β actin, by Merck Group (1 mentions)
Complete protease inhibitor cocktail, by Roche (1 mentions)
Phosstop, by Roche (1 mentions)
Dc protein assay, by Bio-Rad (1 mentions)
11 protocols using ab32024
1
Quantifying Protein Expression in Immune Cells
2
Western Blot Analysis of Apoptosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were separated on denaturing SDS-PAGE gels and transferred onto PVDF membranes. Next, the membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated overnight at 4 °C with anti-ALKBH5 (ab195377, Abcam), anti-EIF4EBP1 (ab32024, Abcam), anti-MLST8 (ab228832, Abcam), anti-Cleaved caspase 8 (9496, CST), anti-Pro caspase 8 (ab108333, Abcam) and anti-P84 (10920-1-AP, Proteintech) antibodies. Then, the membranes were washed and incubated for 1 h with an HRP-conjugated secondary antibody. An ECL chemiluminescence system (Tanon-4800 Multi) was employed for the detection of proteins.
3
Western Blot Analysis of Spinal Cord Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spinal cord tissue and cells were lysed by RIPA with phosphatase inhibitors and protease inhibitors cocktail, and protein concentration was determined using a bicinchoninic acid reagent (ThermoFisher). Equal amount of proteins was separated using 8–12% SDS-PAGE gels, and transferred to polyvinylidene fluoride membranes (Bio-Rad, Hercules, CA, USA). Then the membranes were blocked with 5% nonfat milk and incubated with primary antibodies: Mettl14 (1:1000, #51,104, CST, Beverly, MA, USA), MAP2 (1 µg/mL, ab11267, Abcam), acetyl-α-tubulin (0.06 µg/mL, ab24610, Abcam), Iba-1 (1:500, ab178846, Abcam), RASD1 (0.4 µg/mL, NBP1-91830, Shanghai Univ Biotechnology Co., Ltd., Shanghai, China), p-4EBP1 (1:1000, #2855, CST), t-4EBP1 (1:5000, ab32024, Abcam), p-mTOR (1:1000, ab109268, Abcam), t-mTOR (1:1000, ab32028, Abcam), and secondary antibodies (1:2000, ab205718 or 1:2000, ab205719; Abcam). The bands were examined by the ChemiDic XRS + Imaging System (Bio-Rad), and band intensities were analyzed with Image Lab 3.0 software (Bio-Rad). Experiments were performed at least three times.
4
Myocardial Protein Analysis via RIPA Lysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Left ventricular tissue was placed in the prepared Radio-Immunoprecipitation Assay (RIPA) lysis buffer with 1 mL. The myocardial tissue was fully grounded to extract the protein. Lowry method was used to determine the total protein content. Proteins were isolated by SDS-PAGE gel and transferred to PVDF membrane. The PVDF membrane was sealed with PBS solution containing 5% skimmed milk powder for 1 h and the excess skimmed milk powder was washed away. After adding the diluted first antibodies of mTOR (1:1000; Cell Signaling Technology, CST2983), S6K1 (1:1000; Cell Signaling Technology, AY4775 CST9202), 4EBP1 (1:1000; Abcam, ab32024), eukaryotic translation initiation factor 4E (eIF4E) (1:800; Thermo Fisher, PA5-86047) and GAPDH (1:7000; Proteintech, Wuhan, China, 60004-1-Ig) to PVDF membrane, the membrane was incubated overnight in a shaking bed at 4°C. After washing the PVDF membrane for three times with TBST, the corresponding diluted secondary antibody was added. After incubation at room temperature for 1 h, the membrane was washed with TBST three times again. ECL chemiluminescence liquid developed luminescence, gel imaging system took pictures, and Image Pro Plus image analysis system analyzed protein bands.
5
Neocortex Lysate Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analysis of neocortex lysates by western blot was performed as described18 (link). The following primary antibodies were used: anti-eIF4EBP1 (1:1,000, rabbit, Abcam, ab32024, RRID:AB_2097990), anti-phospho-eIF4EBP1 Thr37/46 (1:1,000, rabbit, Cell Signaling Technology, 2855, RRID:AB_560835), and anti-Gapdh (1:1,000, mouse, Millipore, MAB374, RRID:AB_2107445). All HRP secondary antibodies were used at a dilution of 1:2,500: HRP anti-mouse heavy chain (goat, Abcam, ab97245; RRID:AB_10680049) and HRP anti-rabbit heavy chain (goat, Cell Signaling Technology, 7074S, RRID:AB_2099233).
6
Immunohistochemical Staining of Paraffin-Embedded Tumor Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paraffin blocks that contained sufficient formalin-fixed tumor specimens were serial sectioned at 3 μm and mounted on silane-coated slides for immunohistochemical staining analysis. Dimethylbenzene rehydrated through 100% ethanol, 100% ethanol, 95% ethanol, 85% ethanol and 75% ethanol were applied to deparaffinize. In all, 0.01 mol/L of sodium citrate buffer (pH 6.0) was used to the progress of antigen retrieval treatment (autoclaved at 121°C, 2 min). Then, 3% H2O2 was applied to block endogenous peroxidase at room temperature for 10 min. The sections were washed in PBS solution subsequently and blocked with 10% goat serum (ZhongShan Biotechnology, Beijing, China) for 30 min and incubated with anti-eIF4E (ab33766, 1:100 dilution, monoclonal; Abcam, Cambridge, MA, USA) or anti-eIF4E-BP1 (ab32024, 1:100 dilution, monoclonal; Abcam) antibody or anti-vascular endothelial growth factor C (VEGFC; ab83905, 1:100 dilution, polyclonal; Abcam) or anti-phospho-4E-BP1 (Thr37/46) (236B4) (2855, 1:200 dilution, monoclonal; Cell Signaling Technology, Boston, MA, USA) at 4°C for 12 h. The sections were washed in PBS solution three times and incubated with HRP-conjugated secondary antibody for 30 min at room temperature. All slides were counterstained with diaminobenzidine (DAB) solution and 20% hematoxylin and dehydrated. The primary antibody diluent was regarded as negative control.
7
Immunocytochemistry antibody protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primary antibodies used for immunocytochemistry were used: anti-Satb2 (1:500, rabbit, homemade36 (link)), anti-Bcl11b/Ctip2 (1:500, rat, Abcam, 25B6, RRID:AB_2064130), anti-GFP (1:1,000, goat, Rockland Immunochemicals, RRID:AB_2612804), anti-Cre (1:1,000, rabbit, Synaptic Systems, RRID:AB_2619968), anti-Tbr2 (1:300, rabbit, Abcam, RRID:AB_778267), anti-Pax6 (1:500, rabbit, Millipore, RRID:AB_1587367), Draq5 (1:2,000), anti-eIF4EBP1 (1:1,000, rabbit, Abcam, ab32024, RRID:AB_2097990), and anti-phospho-eIF4EBP1 Thr37/46 (1:1,000, rabbit, Cell Signaling Technology, 2855, RRID:AB_560835). All secondary antibodies were from Jackson ImmunoResearch and were used at a dilution of 1:250.
8
Western Blot Analysis of Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard western blot analysis was performed as described in the literature [22 (link)]. The primary antibodies used in this study were anti-AKT (ab32505, Abcam), anti-phospho-AKT (ab81283, Abcam), anti-GSK3β (ab32391, Abcam), anti-phospho-GSK3β (ab131097, Abcam), anti-mTOR (ab2732, Abcam), anti-phospho-mTOR (ab84400, Abcam), anti-eIF-4E (ab32024, Abcam), anti-phosphoeIF-4E (ab76256, Abcam), anti-PI3K (#4257, CST), anti-phospho-PI3K (#4228, CST), anti-P70S6K (#2708, CST), anti-phospho-P70S6K (#9208, CST), and anti-Actin (ab8227, Abcam).
9
Quantifying FKBP4 Expression and AKT/mTOR Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using Trizol reagent (Life Technologies), and 1.0 μg of total RNA was reverse transcribed into cDNA with a total volume of 20 μl using the PrimeScript RT Master Mix reverse transcription kit (Takara, Japan). Subsequently, PCR reactions were performed using the ABI 7900 system (Applied Biosystems, USA) with the SYBR Select Master Mix kit (Applied Biosystems) and 0.5 μl cDNA. β-Actin was used as an internal reference, and the relative expression of FKBP4 was calculated using the 2-ΔΔCt method. The primer sequences are FKBP4-F: GAAGGCGTGCTGAAGGTCAT, FKBP4-R: TGCCATCTAATAGCCAGCCAG Anti-pan-AKT antibody (ab8805, 1 : 1000, Abcam), anti-AKT (phospho T308) antibody (ab38449, 1 : 1000, Abcam), anti-AKT1 (phospho S473) antibody (ab81283, 1 : 5000, Abcam), anti-mTOR antibody (ab32028, 1 : 1000, Abcam), anti-mTOR (phospho S2448) antibody (ab109268, 1 : 1000, Abcam), anti-mTOR (phospho S2481) antibody (ab137133, 1 : 1000, Abcam), anti-S6K1 (phospho S424) antibody (ab131436, 1 : 1000, Abcam), anti-S6K1 antibody (ab32359, 1 : 1000, Abcam), anti-eIF4EBP1 (phospho T37) antibody (ab75767, 1 : 1000, Abcam), anti-eIF4EBP1 antibody (Y329) (ab32024, 1 : 1000, Abcam), and anti-beta-actin antibody-loading control (ab8226, 1 : 2000, Abcam).
10
Western Blot Analysis of Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HLE-B3 cells were harvested and lysed using a lysis buffer, and the protein concentration of cell extracts was quantified with a BSA kit. Next, appropriately 20 µg protein was loaded on 10 SDS-PAGE gels and transferred into PVDF membranes, followed by blocking with TBST solution containing 5% skim milk at 4 °C for 3 h. Membranes were incubated with primary antibodies at 4 °C overnight and then incubated with secondary antibodies of Goat Anti-Mouse IgG H&L (HRP) (1:1000, ab205719; Abcam, Cambridge, UK) and Goat Anti-Rabbit IgG H&L (HRP) (1:20000, ab6721; Abcam, Cambridge, UK). Finally, the protein bands were imaged using the Bio-Rad ChemiDoc XRS system. Primary antibodies, including GAPDH (1:2000, 60004-1-Lg; Proteintech, Rosemont, IL, USA), METTL3 (1:1000, 15073-I-AP; Proteintech), and EIF4EBP1 (1:2000, ab32024; Abcam, Cambridge, UK), were used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!