Sybr master mix

After drug treatment, mRNA was obtained from cortical or hippocampal tissue and used to generate cDNA. Quantitative real-time RT–PCR (qRT–PCR) was conducted using SYBR master mix (#4368577, ThermoFisher Scientific), with the program recommended by the manufacturer and as published previously (38 (link)). As a reference, we used the housekeeping gene cyclophilin (Ppib), and the relative Ct values of each gene were calculated using the delta Ct, in comparison with the control gene. Duplicated control reactions for every sample without reverse transcription were included to ensure that PCR products were not due to the amplification of contaminated genomic DNA. We used the following sets of primers: cyclophilin F (5’-TGGAGATGAATCTGTAGGAGGAG-3’) and R (5’- TACCACATCCATGCCCTCTAGAA-3), Glut1 (Slc2a1) F (5’-ATGGATCCCAGCAGCA AGAAG-3’) and R (5’-AGAGACCAAAGCGTGGTGAG-3’), Glut3 (Slc2a3) F (5’-GGATCCCTTGTCCTTCTGCTT-3’) and R (5’-ACCAGTTCCCAATGCACACA-3’), Glut4 (Slc2a4) F (5’-CGGCTCTGACGATGGGGAA-3’) and R (5’-TTGTGGGATGGAA TCCGGTCCCGATA-3’). All primers were purchased from IDT Integrated DNA Technologies.

Total RNA was extracted using RNAiso (TaKaRa) and reverse transcribed into cDNA using PrimeScript RT Master Mix Kit (Takara). Realtime‐PCR was conducted using SYBR Master Mix (Thermo). Target gene was normalized to GAPDH using the 2^−ΔΔct method. The primer sequences were as follows:
RASSF4 forward, 5′‐AGTTCGCACTCTACATCGTT‐3′,
RASSF4 reverse, 5′‐CCCATGCAGGATTCTGGAAAT‐3′;
GADPH forward, 5′‐GAAATCCCATCACCATCTTCCAG‐3′,
GADPH reverse, 5′‐GAGCCCCAGCCTTCTCCAT‐3′.

CYP-related RNA expression was assessed to evaluate the metabolic capacity of hiPSC-HLCs after recellularization into scaffolds. For reference, iPSC-HLCs were seeded at a density of 9 × 10⁵ cells/well in a Matrigel-coated 24-well multi dish and cultured for 4 days. Total RNA was extracted using the RNeasy Mini Kit (QIAGEN K.K.), following the manufacturer’s instructions. Complementary DNA was synthesized from 1 μg of total RNA per sample using Prime Script RT Master Mix (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using SYBR Master Mix (Thermo Fisher Scientific K.K., Tokyo, Japan) and QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific K.K., Tokyo, Japan). The primer list is presented in Table 1. PCR data were analyzed using the comparative CT method. Samples of iPSC-HLCs cultured in scaffolds and in dishes were analyzed as biological replicates (n = 3). Each sample was subjected to three technical replicates of each PCR reaction. β-Actin was used as the internal control.

Total RNA was isolated from P. aeruginosa PAO1 biofilm cells using the QIAzol Lysis Reagent (QIAGEN) following the manufacturer's instruction. The reaction mixture was prepared by adding 2 μL template RNA, 10 μL SYBR master mix (Thermo Scientific, USA), 0.8 μL each of the forward and reverse primers (10 mM), 0.4 μL reference dye, and water (RNA free) to make up a 20 μL total volume. Analysis was performed at 50°C for 50 min followed by denaturation for 10 s at 95°C, annealing for 10 s for 55°C, and extension for 35 s at 60°C. Eventually, a dissociation analysis (95°C for 15 s, 60°C for 1 min, and 95°C for 15 s) was also carried out to confirm that absence of non-specific amplicons. The obtained cDNA samples were stored at −80°C. The primer sets for the genes were designed using Primer 3 (v 0.4.0) (Supplementary Table 1).