Pcdna1

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PcDNA1.1 is a plasmid vector designed for high-level transient expression of recombinant proteins in mammalian cell lines. It contains a strong cytomegalovirus (CMV) promoter and a multiple cloning site for inserting the gene of interest. The plasmid also includes a neomycin resistance gene for selection of stable cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Isoguvacine, by Merck Group (2 mentions) β alanine, by Merck Group (2 mentions) 5 aminovaleric acid, by Merck Group (2 mentions) Glycine, by Merck Group (2 mentions) Muscimol, by Merck Group (1 mentions) Gaboxadol, by Merck Group (1 mentions) 4 5 6 7 tetrahydroisoxazolo 5 4 c pyridin 3 ol thip, by Merck Group (1 mentions) Tri reagent, by Molecular Research Center (1 mentions) F12 medium, by American Type Culture Collection (1 mentions) Cos 1 cells, by American Type Culture Collection (1 mentions) Sh sy5y, by American Type Culture Collection (1 mentions) Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

PcDNA1/Amp expression vector

4 protocols using pcdna1

Expressing and Analyzing GABA-ρ Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The subcloned human GABA-ρ1 cDNA into pcDNA1.1 (Invitrogen, San Diego, CA, USA) was generously donated by Dr. George Uh1 (National Institute for Drug Abuse, Baltimore, MD, USA). The subcloned human GABA-ρ2 cDNA into PKS (Invitrogen) was generously provided by Dr. Garry Cutting (Center for Medical Genetics, Johns Hopkins University School of Medicine, Baltimore, MD, USA).
GABA, muscimol, β-alanine, 5-amino valeric acid, glycine, isoguvacine, and imidazole-4-acetic acid were purchased from Sigma-Aldrich (Sigma-Aldrich Pty Ltd., Castle Hill, NSW 1765, Australia). TACA and CACA were prepared as previously reported [3 (link)].

Naffaa M.M., Hibbs D.E., Chebib M, & Hanrahan J.R. (2022). Pharmacological Effect of GABA Analogues on GABA-ρ2 Receptors and Their Subtype Selectivity. Life, 12(1), 127.

+ Open protocol

+ Expand

Recombinant Expression of Human GABA Receptor

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human ρ1 cDNA subcloned into pcDNA1.1 (Invitrogen, San Diego, CA, USA) was kindly provided by Dr. George Uh1 (National Institute for Drug Abuse, Baltimore, MD, USA).
(GABA, 5-aminovaleric acid, β-alanine, glycine, isoguvacine, 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) also known as Gaboxadol, were purchased from Sigma-Aldrich (Sigm-Aldrich Pty Ltd, Castle Hill, NSW 1765 Australia). 1,2,5,6-Tetrahydropyridin-4-yl)methylphosphinic acid (TPMPA) [31 (link)], trans-aminocrotonic acid (TACA) and cis-aminocrotonic acid (CACA) [32 (link)], and 2-aminoethylmethane thiosulfonate (MTSEA) [33 (link)] were prepared as previously reported.

Naffaa M.M., Absalom N., Solomon V.R., Chebib M., Hibbs D.E, & Hanrahan J.R. (2016). Investigating the Role of Loop C Hydrophilic Residue ‘T244’ in the Binding Site of ρ1 GABAC Receptors via Site Mutation and Partial Agonism. PLoS ONE, 11(5), e0156618.

+ Open protocol

+ Expand

Cloning and Characterization of ERK1b

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR was made with Taq (Promega) and RT‐PCR with RT‐PCR Beads (Amersham Pharmacia Biotech) according to the manufacturer's instructions with the oligonucleotides as follows: ERK1‐NT: 5′‐STGGTGAAGGGGCAGCCATTCGACGT‐3′; ERK1–850‐S: 5′‐TACCTACAGTCT CTGCCCTCTAAA‐3′; ERK1‐CT‐AS: 5′‐AAGCGGGCTTCTCTTGGAAGAT‐3′; ERK1b‐NT‐S: 5′‐GTAAG CCGGCCACCAGC‐3′; and ERK1b‐CT‐AS: 5′‐CTGGGGGC‐AAAGACAGT‐3′. Total RNA was prepared using TRI reagent (Molecular Research Center Inc.) according to the manufacturer's instructions. For cloning of HA‐ERK1b and HA‐ERK1, the rat constructs obtained with RT‐PCR were ligated to the 3′ of HA and into the EcoRI and XhoI sites of pCDNA1 (Invitrogen).

Yung Y., Yao Z., Hanoch T, & Seger R. (2022). ERK1b, a 46‐kDa ERK isoform that is differentially regulated by MEK. Cell Biology International, 46(7), 1021-1035.

+ Open protocol

+ Expand

Transient and Stable Transfection of KCNC3 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

COS-1 cells (ATCC, CRL 1650) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Omega) with 10% FBS (Omega), 4 mM glutamine, and antibiotic/antimycotic (ABAM) (Gibco) at 37°C in humidified air with 5% CO₂. Human neuroblastoma cells, SH-SY5Y (ATCC, CRL 2266) were cultured similarly in 1:1 Eagle's Minimum Essential Medium: F12 Medium (ATCC, 30-2003). The human KCNC3^WT cDNA was kindly provided by Dr. James L. Rae (Mayo Foundation) (Rae and Shepard, 2000 (link)) and subcloned into pcDNA1 (Invitrogen). KCNC3^WT and individual mutants (KCNC3^R420H or KCNC3^F448L) were generated by Quikchange Mutagenesis (Stratagene) and used for transient transfection in COS-1 cells. For co-transfection, equimolar amounts (1:1) of each plasmid were used. cDNAs for KCNC3^WT, KCNC3^R420H or KCNC3^F448L were subcloned into a pEF-IRES-puro vector for stable selection in SH-SY5Y cells using puromycin and individual colonies selected for clonal expression. Transfections were performed using Lipofectamine LTX (Invitrogen) as per manufacturer's instructions.

Gallego-Iradi C., Bickford J.S., Khare S., Hall A., Nick J.A., Salmasinia D., Wawrowsky K., Bannykh S., Huynh D.P., Rincon-Limas D.E., Pulst S.M., Nick H.S., Fernandez-Funez P, & Waters M.F. (2014). KCNC3R420H, a K+ Channel Mutation Causative in Spinocerebellar Ataxia 13 Displays Aberrant Intracellular Trafficking. Neurobiology of disease, 71, 270-279.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!