Pires2 egfp plasmid

PCDH19-V5 and CTF-V5 in cFUW, PCDH19-879Δ in cFUW-RFP, GST-CTF in pGEX 4T1, PCDH9 in pIRES2, PCDH19 shRNA (rat-specific target sequence 5′-gagcagcatgaccaatacaat-3′) and control shRNA (scramble, target sequence 5′-gctgagcgaaggagagat-3′) in pLVTHM vector were previously described in (Bassani et al., 2018 (link)).
The sequence of CTF-V5 in cFUW was mutated in correspondence of the first of the two basic regions (BR1 and BR2) that compose PCDH19 CTF putative NLS (CTF-V5 NLS_BR1BR2, amino acids 760-782, RGKRIAEYSYGHQKKSSKKKKIS). Amino acids 760, 762 and 763 were replaced by alanines by using the Agilent Technologies QuickChange II XL Site-Directed Mutagenesis Kit (Agilent, USA) to obtain a mutant CTF-V5 (CTF-V5 NLS_br1BR2, AGAAIAEYSYGHQKKSSKKKKIS, mutant amino acids in italics). The primers in Table S9 were used for mutagenesis.
PCDH19 shRNA target sequence was modified for use in hiPSCs-derived neurons (human-specific target sequence 5′-GAGCAGCACGACCAATACAAC-3′) and cloned in pLVTHM vector (Addgene). PCDH19 CTF and its proximal and distal parts (CTFa, aa 700-890 and CTFb, aa 891-1148) were subcloned in pCMV-HA (Clontech) to obtain HA-CTF, HA-CTFa, and HA-CTFb. HA-LSD1 and HA-nLSD1 in pCGN were previously described in (Toffolo et al., 2014 (link)). NOVA1 was subcloned in pCGN-HA vector (Rusconi et al., 2015 (link)). pIRES2 EGFP plasmid was from Clontech.

Because human and murine mRNAs and proteins for gremlin exhibit high homology (89% and 98%, respectively), all of the experiments were performed using the human sequence. GREM1 cDNA was purchased from the Mammalian Gene NIH Collection (Bethesda, Maryland USA). To facilitate the detection of human gremlin (as opposed to the endogenous mouse protein), we added a c-myc tag to the 3′ portion of GREM1 using PCR with the forward primer 5′AGTGCGGCGGCTGAGGACCC GCCGCACTGACAT-3′ and the reverse primer 5′-ATAGCCGCCGCTTACAGATCCTCTTCTGAGATGAGTTTTTGTTCATCCAAATCGATGGATATGC-3′. To add another signal to the transgene to facilitate detection in transfected cells, we inserted an e-GFP sequence downstream of human gremlin as follows. The IRES-eGFP sequence was obtained by PCR using a pIRES2-EGFP plasmid (Clontech Mountain View, CA, USA) as the template with the following primers: IRES-eGFP-F (5′-TACATTAATGGGCCCGGGATCCGCCCCTC-3′) and IRES-eGFP-R (5′-GGCCATATGCGCCTTAAGATACATTGATG-3′). The GREM1-c-myc and IRES-eGFP fragments were independently cloned into a pGEMT-Easy vector and then sequenced (Macrogen, Seoul, Korea) to confirm the modifications and absence of additional mutations. Next, both the GREM1-c-myc and IRES-eGFP fragments were subcloned into a modified pCDNA3 vector using the EcoRI and NotI restriction sites, respectively.

The pT2HB-PUHrT62 and pT2-β-actin plasmids were gifts from Professor Zongbin Cui in the Institute of Hydrobiology, Chinese Academy of Sciences (unpublished); T2KXIG^{47 (link)} and pTol2mini (pDB739)^{59 (link)} vectors were kindly provided by Professor Koichi Kawakami and Professor Stephen C Ekker respectively.
The rtTA DNA fragment was amplified from the pT2HB-PUHrT62 plasmid. The amplified rtTA DNA fragment was cloned into a pIRES₂-EGFP plasmid (Clontech) to generate the prtTA-IRES2-EGFP construct. TRE3G promoter^{60 (link)} was synthesized by the Biosune Company.
The core element of the chicken β-globin insulator was synthesized by the Biosune Company. Construction of ubi-pIDM vector: The ubi-promoter-rtTA-T2A-RFP-SV40 poly-A cassette was used to replace the β-actin promoter-rtTA-IRES-EGFP-SV40 poly-A cassette to form ubi-pIDM vector. The ubi promoter was from the Tg(ubi:loxP-DsRed-STOP-loxP-EGFP) plasmid clone as previously reported^{61 (link)}, and the T2A peptide was described previously³⁷ .
The sequences of all primers are provided in Supplementary Table 1. The details of the construction are provided in Detailed protocol of Supplementary Materials.