Revertaid h minus

Total RNA was isolated using TRIzol (Thermo Fisher Scientific), and cDNA was generated as described [4 (link)] using RevertAid H Minus reverse transcriptase (Thermo Fisher Scientific). Quantitative real-time PCR of mouse Siglec-E, TNF and IL-6 was performed in 10-µl 1:2 diluted BIO SyGreen Lo-ROX mix (PCR Biosystems, London, UK) with ImageQuantQ3 and ImageQuant software (Thermo Fisher Scientific) using the comparative threshold cycle (ΔC_T) method as described elsewhere [27 (link)] with HPRT and PPIA as reference genes [28 (link)]. The following primers were used: HPRT, 5′- TTCCTCATGGACTGATTATGGACA-3′ (forward) and 5′- AGAGGGCCACAATGTGATGG -3′ (reverse); PPIA, 5′- CCACAGTCGGAAATGGTGAT-3′ (forward) and 5′- TGCACTGCCAAGACTGAATG-3′ (reverse); TNF, 5′- CTGTAGCCCACGTCGTAGC-3′ (forward) and 5′- TTGAGATCCATGCCGTTG-3′ (reverse) [29 (link)]; IL-6, 5′-GGCCTTCCCTACTTCACAAG -3′ (forward) and 5′-ATTTCCACGATTTCCCAGAG -3′ (reverse) [30 (link)]; Siglec-E 5′-TGGTACAGGGAAGGAACCGA -3′ (forward) and 5′-GTGAGGGCTGTTACAACCAGA -3′ (reverse). The NCBI primer designing tool with Primer3 version 4.1 [31 (link), 32 (link)] was used to select Siglec-E-specific primers.

Fusion transcripts for validation were selected among SCAN‐B tumours with available RNA and small RNA sequencing data. Transcripts where the fusion junction overlapped repetitive elements annotated by RepeatMasker were excluded to allow design of specific primers. Total RNA was treated with DNase I (ThermoFisher Scientific) and 200 ng was used for cDNA synthesis with random hexamers in 10 μL reactions using RevertAid H Minus reverse transcriptase (ThermoFisher Scientific) according to the manufacturer's instructions. The cDNA was diluted 1:3 with H₂O and 2 μL were used in 15 μL reactions for real‐time quantitative RT‐PCR with iTaq Universal SYBR Green Supermix (Bio‐Rad) according to the manufacturer's instructions. For miRNAs, cDNA synthesis from 100 ng DNase‐treated total RNA was performed as described.²⁴ Dilution of cDNA and PCR was done as before. Primer sequences are available in Table S1.

Four overlapping PCR amplicons were generated from CHIKV RNA via cDNA synthesis using RevertAid H Minus reverse transcriptase (Thermo Fisher Scientific), RiboLock RNase inhibitor (Thermo Fisher Scientific), 5× reaction buffer, 10 mM deoxynucleoside triphosphate mix, and primers (sequences available upon request). In the second step, combinations of primers (sequences available upon request) were used to generate five PCR products with the following program: 5 min at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 55°C, and 3 min at 72°C and terminated by 10 min at 72°C. Amplicons were gel purified and sequenced using 18 primers (sequences available upon request). The nucleotide sequences were assembled in Geneious software 9.1.5, and the complete genomes of the resistant variants were compared to the CHIKV-LS3 genome.