Escherichia coli dh5α competent cells

Cloning experiments were performed in Escherichia coli DH5α competent cells (Invitrogen). E. coli DH5α transformants were grown in Lysogeny Broth (LB) or on LB agar at 37°C supplemented with ampicillin (100 μg/ml), as all plasmids used in this study (Table 1) contain an ampicillin resistance (bla) gene. All Staphylococcus strains (Table 1) were grown in brain heart infusion (BHI) medium or agar, and for biofilm formation assays also in BHI medium supplemented with 4% NaCl (BHI-NaCl) or 1% glucose (BHI-glucose). Bacterial CFU counting was done on Tryptone Soya agar (TSA, Oxoid) or blood agar plates (BD Biosciences). Whenever required, growth media were supplemented with appropriate antibiotics as follows: chloramphenicol at 10 μg/ml, erythromycin at 10 μg/ml and tetracycline at 5 μg/ml. Species identification and antibiograms for all clinical isolates were performed using a VITEK^® 2 automated system (bioMérieux).

Agarose gel extraction kits (Qiagen) were used to purify positive PCR products. The purified products were introduced into pGEM-T Easy vectors (Promega, Madison, WI, USA), according to the provided instructions. The ligated products were then transformed into Escherichia coli DH5α-competent cells (Thermo Fisher Scientific, Wilmington, DE, USA), and the cells were incubated at 37 °C overnight. Plasmid DNA was extracted using the Plasmid Miniprep Kit (Qiagen), according to the provided instructions.

For positive PCR products, DNA cloning was performed using pGEM-T Easy vectors (Promega, Madison, WI, USA) and Escherichia coli DH5α-competent cells (Thermo Fisher Scientific, Wilmington, DE, USA). Following cloning, nucleotide sequencing was performed with the multiple sequence alignment program CLUSTAL Omega (v. 1.2.1) [22 (link)]. Sequence alignment results were modified by BioEdit (v. 7.2.5) [23 ]. Phylogenetic analysis was conducted using MEGA (v. 6.0) [24 (link)], according to the maximum likelihood method with the Kimura two-parameter distance model. A similarity matrix was used to analyze the aligned sequences. The trees’ stability was assessed by a bootstrap analysis using 1000 replicates.

The production of the HKU1-NLCt antigen, starting with the generation of the plasmid construct to the expression of the protein, was done similarly to previously described methods (Dijkman et al., 2012 (link)). In short, the HKU1-NLCt gene fragment was amplified using PCR with Q5 High Fidelity DNA Polymerase (New England Biolabs, Ipswitch, MA, United States). The template used in the PCR was the full nucleocapsid protein gene from HCoV-HKU1 strain Caen1 (GenBank accession number HM0384837.1), and the sequences for the forward and reverse primer were 5′ – CACCACTAGGTTTCCGCCTG – 3′ (5′-HKU1-NLCt) and 5′–TTAAGCAACAGAGTCTTCTACATAAG–3′ (3′-HKU1-end), respectively. The PCR product was cloned into pET/100/D-TOPO expression plasmids (Thermo Fisher Scientific, Waltham, MA, United States), which were transformed into Escherichia coli DH5α competent cells (Thermo Fisher Scientific). Sequencing on the generated pET-HKU1-NLCt plasmid confirmed that the cloned gene was identical to Caen1. The HKU1-NLCt antigen was then expressed and purified using steps described previously (Dijkman et al., 2008 (link)). Since the first purified product still contained impurities (assumed to be bacterial proteins, Supplementary Figure 1A), the purification step was done two times (Supplementary Figure 1B).

The egfp gene was selected as an internal amplification control (IAC), as described by Bliem et al. [14 (link)]. A pJET1.2 vector (Thermo Fischer Scientific Inc., Waltham, MA, USA) containing the egfp insert was kindly provided by Bliem et al., and was cloned into Escherichia coli DH5α competent cells (Thermo Fischer Scientific Inc., Waltham, MA, USA). The plasmid was purified using the QIAprep Spin Miniprep Kit (QIAGEN GmbH, Hilden, Germany) and the quantity and purity of the plasmid was measured using a NanoDrop2000 instrument (Thermo Fischer Scientific Inc., Waltham, MA, USA). The plasmid was diluted to 250 copies/µL in PCR grade water (Promega Corporation, Vienna, Austria) and stored at −20 °C until use.

For positive PCR products, DNA cloning was done using pGEM-T Easy vectors (Promega, Madison, WI, USA) and Escherichia coli DH5α-competent cells (Thermo Fisher Scientific, Wilmington, DE, USA). Two bacterial colonies from each PCR product were followed by nucleotide sequencing using the multiple sequence alignment program CLUSTAL Omega (v. 1.2.1), and the alignment was edited using BioEdit (v. 7.2.5). Phylogenetic analysis was performed using MEGA (v. 6.0), and was based on the maximum likelihood method with the Kimura two-parameter distance model. The aligned sequences were analyzed using a similarity matrix. The stability of the trees was estimated via bootstrap analysis using 1000 replicates.