Pcr thermal cycler dice real time system 3

The extracted DNA was amplified using primers (targeting V1-V3 region of the 16S rRNA gene) with adapters (forward: 5′-adapter [TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAG]-GAGTTTGATCMTGGCTCAG-3′; reverse: 5′-adapter [GTCTCGTGGGCTCGGAGATGTGTATAAGAG ACAG]-ATTACCGCGGCTGCTGG-3′). PCR amplification followed preparation of a 16S metagenomics sequencing library for the MiSeq system (Illumina, Inc., San Diego, CA, United States) was performed as described previously (Lee et al., 2017 (link); Kim et al., 2019 (link)). The library was quantified using a PCR Thermal Cycler Dice Real-Time System III (Takara Bio.) with the GenNext NGS Library Quantification Kit (Toyobo, Osaka, Japan). Equimolar concentrations of each library from the different samples were pooled and sequenced using an Illumina MiSeq system (300 bp-paired ends), following the manufacturer’s instructions.

As described previously, the relative bacterial amount in each sample was estimated and compared using quantitative real-time PCR based on the 16 S rRNA gene^{56 (link),58 (link)}. Amplification was performed with a PCR Thermal Cycler Dice Real Time System III (Takara Bio) using the following primers: 340 F (5′-TCCTACGGGAGGCAGCAG-3′) and 518 R (5′-ATTACCGCGGCTGCTGG-3′). For each sample, reactions were performed in triplicate with a final reaction volume of 25 µL, comprising 12.5 µL of 2× TB Green Premix Ex Taq (Tli RNaseH Plus; Takara Bio), 20 µM of each primer, and 2 µL of DNA template (ten-fold diluted metagenomic DNA) or distilled water (negative control). The amplification program was as follows: initial denaturation at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 30 s, with a final extension at 72 °C for 10 min. Standard curves were generated by performing serial dilution representing log concentrations of the copy number of the 16 S rRNA gene from Escherichia coli K12 w3110. The regression coefficient (r²) for all standard curves was ≥ 0.99.