Easypure viral rna kit

Manufactured by Transgene

Sourced in China

The EasyPure Viral RNA Kit is a laboratory equipment designed for the rapid and efficient extraction of viral RNA from various sample types. The kit utilizes a spin-column-based method to isolate high-quality viral RNA suitable for downstream applications such as RT-PCR and gene expression analysis.

Automatically generated - may contain errors

Lab products found in correlation

Dnase 1, by Thermo Fisher Scientific (3 mentions) Revertaid first strand dna synthesis kit, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 2 real time pcr detection system, by Roche (1 mentions) Transcriptor first strand cdna synthesis kit, by Roche (1 mentions) Easyscript one step rt pcr supermix, by Transgene (1 mentions) Primescript rt master mix, by Takara Bio (1 mentions) Transscript probe one step qrt pcr supermix, by Transgene (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Smarter race cdna amplification kit, by Takara Bio (1 mentions)

Close spelling variants of this product

EasyPure RNA Kit (139 citations) EasyPure Viral DNA/RNA Kit (60 citations)

10 protocols using easypure viral rna kit

Quantifying HBV RNA and DNA in THLE-2 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantification of HBV RNA in THLE-2 cells was performed as previously described [24 (link)]. HBV RNA was isolated using the EasyPure Viral RNA Kit (TransGen Biotech, Beijing, China) and reverse transcribed using RevertAid First Strand DNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). The levels of HBV RNA were detected by quantitative real-time PCR with a SYBR Green or TaqMan probe method using LightCycler 480 II Real-time PCR Detection System (Roche, Mannheim, Germany).
The level of HBV DNA was quantified by artus HBV PCR Kits CE (QIAGEN) according to the manufacturer’s instructions.

Fu X., Ouyang Y., Mo J., Li R., Fu L, & Peng S. (2020). Upregulation of microRNA-328-3p by hepatitis B virus contributes to THLE-2 cell injury by downregulating FOXO4. Journal of Translational Medicine, 18, 143.

+ Open protocol

+ Expand

FMDV RNA Extraction Using EasyPure Kit

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted using EasyPure viral RNA kit (TransGen Biotech, Beijing, China) according to the manufacturer's instructions. Briefly, FMDV RNA was isolated from 200 μL sample as starting materials and RNA was eluted in a final volume of 30 µl RNase-free water. RNA extracts were either used directly after extraction or kept at − 20 °C for further analysis.

Hassan A.M., Zaher M.R., Hassanien R.T., Abd-El-Moniem M.I., Habashi A.R., Ibraheem E.M., Shahein M.A., El Zowalaty M.E, & Hagag N.M. (2022). Molecular detection, phylogenetic analysis and genetic diversity of recently isolated foot-and-mouth disease virus serotype A African topotype, Genotype IV. Virology Journal, 19, 1.

+ Open protocol

+ Expand

HBV Nucleic Acid Extraction and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HBV DNA and RNA in the culture medium of HepAD38 cells and sera of patients were extracted using the EasyPure Viral RNA Kit (TransGen Biotech, Beijing, China), according to the manufacturer’s instructions. For HBV‐RNA extraction, the products were further treated with DNase I (Thermo Fisher Scientific, Waltham, MA). Isolated HBV RNA was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit with random primers for RT‐PCR (Roche, Basel, Switzerland), in accord with the manufacturer’s instructions.

Liu Y., Liu H., Hu Z., Ding Y., Pan X., Zou J., Xi J., Yu G., Huang H., Luo M., Guo F., Liu S., Sheng Q., Jia J., Zheng Y., Wang J., Chen X., Guo J., Wei L, & Lu F. (2019). Hepatitis B Virus Virions Produced Under Nucleos(t)ide Analogue Treatment Are Mainly Not Infectious Because of Irreversible DNA Chain Termination. Hepatology (Baltimore, Md.), 71(2), 463-476.

+ Open protocol

+ Expand

Extraction and Transfection of ATMUV Genomic RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ATMUV genomic RNA (VG RNA) was extracted from the purified virus particles using EasyPure Viral RNA Kit (TransGen Biotech, Beijing Co., Ltd) according to the manufacturer’s instructions and viral RNA was isolated from ATMUV infected CEF cells and control cellular RNA were prepared from uninfected CEF cells as previously described [33 (link)]. Approximately 2.0 × 10⁶ CEF cells per well in 6-well plates were transfected with 3 μg of VG-RNA, viral RNA and cellular RNA using Lipofectamine 2000 Transfection Reagent, respectively. The samples were examined by RT-PCR analysis 6 h after transfection.

Chen S., Luo G., Yang Z., Lin S., Chen S., Wang S., Goraya M.U., Chi X., Zeng X, & Chen J.L. (2016). Avian Tembusu virus infection effectively triggers host innate immune response through MDA5 and TLR3-dependent signaling pathways. Veterinary Research, 47, 74.

+ Open protocol

+ Expand

FMDV Genome Extraction and Serotyping

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The viral genome extraction was carried out using EasyPure viral-RNA kit (TransGen Biotech, Beijing, China). Based on the amplification of the most conserved segment of the FMDV-RNA polymerase gene (3D gene), Quantitative Real-time Reverse-Transcription Polymerase Chain Reaction (qRT-PCR) was carried out for FMDV detection using the pan-FMDV primers/probe set as shown in (Callahan et al., 2002 (link)). The partial genomic analysis with the serotype-distinguishable protein, VP1, was performed for FMDV serotyping using three-selective primers for serotypes A, O, and SAT2 as given in (Hassan, et al., 2022a (link)). The procedures were performed using the EasyScript One-Step RT-PCR SuperMix (TransGen, Beijing, China).

Hagag N.M., Hassan A.M., Zaher M.R., Elnomrosy S.M., Shemies O.A., Hussein H.A., Ahmed E.S., Ali M.H., Ateay M., Abdel-Hakim M.A., Habashi A.R., Eid S., El Zowalaty M.E, & Shahein M.A. (2022). Molecular detection and phylogenetic analysis of newly emerging foot-and-mouth disease virus type A, Lineage EURO-SA in Egypt in 2022. Virus Research, 323, 198960.

+ Open protocol

+ Expand

Quantitative Analysis of HBV RNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EasyPure Viral RNA Kit (TransGen Biotech, ER201-01) was used for RNA extraction. Isolated HBV RNA was reverse transcribed using PrimeScript™RT Master Mix (Takara, RR036A) with random primers and reverse transcription was carried out as the manufacturer instructed. The quantification of HBV DNA was performed with the ABI 7500 real-time PCR system. Primers to detect HBV 3.5 kb-pgRNA was described previously [22 (link)]. Primers used to detect HBV 3.5 kb RNA were as follows: F: 5′-AYA GAC CAT CAA ATG CCC-3′, and R: 5′-ATT CTC AGA CCG TAG CAC ACG ACA C-3′. The primers used to detect HBV total RNA were as follows: F: 5′-TCA CCA GCA CCA TGC AAC-3′, and R: 5′-AAG CCA CCC AAG GCA CAG-3′. Primers used to detect HNF4α and HNF1α were as follows: F-4a: 5′-GAG TGG GCC AAG TAC A-3′, R-4a: 5′-GGC TTT GAG GTA GGC ATA-3′, F-1a: 5′-TGT GCG CTA TGG ACA G-3′, R-1a: 5′-GTG TTG GTG AAC GTA GGA-3′. Primers specific to GAPDH (internal control) were as follows: F: 5′-GAT TCC ACC CAT GGC AAA TTC CA-3′, R: 5′-TGG TGA TGG GAT CAT TGA TGA-3′. The real-time PCR reaction mixture (20 μL) contained 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 10 μL SYBR PCR mix (takara RR420A), 0.4 μL ROX and 8 μL cDNA. The thermocycling conditions were: hot start at 95 ℃ for 5 min, and 40 cycles of 95 ℃ for 30 s, 60 ℃ for 20 s, 72 ℃ for 30 s, followed by 1 cycle of 72 ℃ for 60 s.

Pan Y., Ke Z., Ye H., Sun L., Ding X., Shen Y., Zhang R, & Yuan J. (2019). Saikosaponin C exerts anti-HBV effects by attenuating HNF1α and HNF4α expression to suppress HBV pgRNA synthesis. Inflammation Research, 68(12), 1025-1034.

+ Open protocol

+ Expand

FMDV RNA Detection via RT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The infected BHK-21 cells of the third passage were harvested. BHK-21 cells were lysed via three successive freezing and thawing cycles and centrifuged at 1200× g for 20 min, then the supernatant was filtrated using syringe filters (0.2 µm). Whole genomic RNA was extracted using the EasyPure viral-RNA kit (TransGen Biotech, Beijing, China) according to manufacturer instructions. FMDV genomic RNA was investigated in the extracted RNA samples via RT-PCR using the pan-FMDV primers/probe set as described [30 (link)]. The RNA reverse transcription step was included in the amplification cycle (45 °C for 25 min) according to the manufacturer instructions of the TransScript^® Probe one-step qRT-PCR SuperMix (TransGen, Beijing, China). The PCR thermal cycle was performed on a BAX Q7 cycler (BAX Q7 systems, Marsiling, Singapore) as described previously [14 (link)].

Metwally S., Bkear N., Badr Y., Elshafey B., Alhag S.K., Al-Shuraym L.A., Batiha G., Fakhry B, & Hamada R. (2023). A Newly Emerging Serotype A Strain in Foot-and-Mouth Disease Virus with Higher Severity and Mortality in Buffalo than in Cattle Calves in North Egypt. Veterinary Sciences, 10(8), 488.

+ Open protocol

+ Expand

Quantitative Analysis of HBV RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HBV RNA was extracted by the EasyPure Viral RNA Kit (TransGen Biotech, China) according to the manufacture’s instruction, and was treated with DNase I (Thermo Fisher Scientific, USA) at 37°C for 30 min. The levels of HBV RNA were detected by RT-qPCR in Applied Biosystems StepOnePlus Real-Time PCR Systems (Applied Biosystems, Mannheim, USA) with a TaqMan probe method. The RT-qPCR reaction mixture (50 μL) contained 25 μL RT-qPCR mix (Hotgen, Beijing, China), 1.5 μL forward primer (10 μM), 1.5 μL reverse primer (10 μM), 1 μL TaqMan probe (10 μM), 15 μL DNase I-treated HBV RNA and 6 μL ddH₂O. The experiments were performed using the following protocol: one cycle at 45 °C for 15 min, one cycle at 95 °C for 5 min, 40 cycles at 95 °C for 10 s and 60°C for 45 s. The standard curves for preC/C-RNA, SF-RNA and XR-RNA primers were drawn and calibrated by the same plasmid standard containing 1.2× wild-type HBV genome which contained one copy preC/C-RNA region, one copy SF-RNA region and two copies XR-RNA region, and was 10-fold serially diluted to prepare the standards with a series of concentrations.

Yu G., Chen R., Zheng S., Liu Y., Zou J., Gu Z., Jiang B., Gao Q., Dai L., Peng J., Wang J, & Lu F. (2022). A standardized assay for the quantitative detection of serum HBV RNA in chronic hepatitis B patients. Emerging Microbes & Infections, 11(1), 775-785.

+ Open protocol

+ Expand

Viral Genome Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral genome extraction was performed using the EasyPure viral RNA kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. RNase-free water (30 μL) was added to 200 μL of processed sample. Elution was performed at 20 ± 3°C for 10 min and the genomic extracts were subjected to thermal amplification or stored at −20°C until use.

Shahein M.A., Hussein H.A., Ali M.H., Ghoniem S.M., Shemies O.A., Afify A.F., Fuoad A.A., Hassan A.M., Zaher M.R., Ela N.H., Habashi A.R., Eid S, & Hagag N.M. (2023). Circulating foot-and-mouth disease virus serotype A African-genotype IV in Egypt during 2022. Veterinary World, 16(7), 1429-1437.

+ Open protocol

+ Expand

Isolation and Amplification of HBV RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HBV RNA in fraction 26 of sucrose density gradient centrifugation was isolated using the EasyPure Viral RNA Kit (TransGen Biotech, Beijing, China) according to the manufacturer's instructions, and treated with DNase I (Thermo Fisher Scientific, Waltham, MA, USA). RACE amplification was performed using the SMAR-Ter TM RACE cDNA Amplification Kit (Clontech, Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer's instructions. Briefly, the SMARTer first strand synthesis was performed using the SMARTer II A oligonucleotide (AAG CAGTGGTATCAACGCAGAGTACXXXXX; X = undisclosed base in the proprietary SMARTer ologo sequence). The sequence of HBV specific RT primer was 5 0 -CGA GATTGAGATCTTCTGCGAC-3 0 . The sequences of HBV specific reverse primers used for semi-nested PCR were: R1: 5 0 -GTTGATAAGATAGGGGCATTTGGTGGTC-3 0 , and R2: 5 0 -GAAGGAAAGAAGTCAGAAGGCAA-3 0 . Both of forward primer was: 5 0 -CTAA TACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3 0 .

Wang J., Shen T., Huang X., Kumar G.R., Chen X., Zeng Z., Zhang R., Chen R., Li T., Zhang T., Yuan Q., Li P.C., Huang Q., Colonno R., Jia J., Hou J., McCrae M.A., Gao Z., Ren H., Xia N., Zhuang H, & Lu F. (2016). Serum hepatitis B virus RNA is encapsidated pregenome RNA that may be associated with persistence of viral infection and rebound. Journal of hepatology, 65(4).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!