RNA was isolated from formalin-fixed paraffin-embedded (FFPE) tissue sections using RNeasy FFPE Kit of Qiagen (Hilden, Germany) and quantified spectrophotometrically using NanoDrop-1000 (Waltham, United States). Molecular analysis was performed using the TruSight RNA Fusion Panel (Illumina, Inc., San Diego, CA, USA) with 500 ng RNA as input according to the manufacturer`s protocol. Libraries were sequenced on a MiSeq (Illumina, Inc., San Diego, CA, USA) with > 3 million reads per case, and sequences were analyzed using the RNA-Seq Alignment workflow, version 2.0.1 (Illumina, Inc., San Diego, CA, USA). The RNA-Seq alignment app (Illumina) was employed to call fusions by using the TopHat-Fusion algorithm. Additionally, the Integrative Genomics Viewer (IGV), version 2.2.13 (Broad Institute, REF) was used for data visualization of fusions.
Nanodrop 1000
Manufactured by Qiagen
Sourced in United States
The NanoDrop-1000 is a spectrophotometer that measures the concentration and purity of DNA, RNA, and protein samples. It requires only a small sample volume, typically 1-2 microliters, to perform the measurement. The instrument uses a innovative sample retention system that eliminates the need for cuvettes or other sample containment devices.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy ffpe kit, by Qiagen (6 mentions)
Trusight rna fusion panel, by Illumina (6 mentions)
Rna seq alignment workflow, by Illumina (4 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Rna seq alignment app, by Illumina (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Oligo dt primer, by Thermo Fisher Scientific (2 mentions)
M mlv rt, by Thermo Fisher Scientific (2 mentions)
Cfx96 qpcr system, by Bio-Rad (2 mentions)
Qiazol buffer, by Qiagen (2 mentions)
Ssofast probes supermix, by Bio-Rad (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Iscript kit, by Qiagen (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Rnaeasy plus micro kit, by Qiagen (1 mentions)
Qiazol solution, by Qiagen (1 mentions)
Qiashredder column, by Qiagen (1 mentions)
Nsg mice, by Jackson ImmunoResearch (1 mentions)
Rnalater solution, by Qiagen (1 mentions)
16 protocols using nanodrop 1000
1
Detecting RNA Fusions in FFPE Tissue
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative polymerase chain reaction (qPCR) analysis, cells were washed and then lysed in RLT Lysis Buffer plus beta-mercaptoethanol (10 μL per 1 mL of buffer, Sigma, Catalog# M6250). RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Catalog# 74134) according to manufacturer instructions. RNA quantity was measured using a NanoDrop 1000, reverse transcribed into cDNA using iSCRIPT kit (Qiagen, Catalog# #1708890) using a Corbett Research RG 3000 thermal cycler. cDNA was used for qPCR on the QuantStudio 3 Real-Time PCR System (Applied Biosystems) using SYBR Green Fast Master Mix (Applied Biosystems, Catalog# 4385612) and primers targeting intron-spanning mRNA sequences. Fold-change in gene expression relative to untreated controls was normalized to GAPDH or 18-S and quantified using the ΔΔ CT method. Statistical significance was assessed using the Student’s t-test. Primer sequences were as follows (forward, reverse, 5′➔3′): IL-1α (F: CGCTTGAGTCGGCAAAGAAAT, R: CTTCCCGTTGCTTGACGTTG), Ccl-2 (F:TGCCCACGTCAAGGAGTATTTCTA, R:CCTGCTGCTGGTGATTCTCTT), 18-S (F: GTAACCCGTTGAACCCCATT, R: CCATCCAATCGGTAGTAGCG), mTOR (F: GGCCTAGAAGACAGCGGG, R: AGCATCTTGCCCTGAGGTT), Ccl-6 (F: ATCCTTGTGGCTGTCCTTGG, R:TGAAGAAGTGTCTTGAAAGCCTTG).
3
Quantifying Huntingtin Transcript Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh striatal, cortical, and cerebellar tissue was dissected from mice at 2 months of age, snap‐frozen in liquid nitrogen and stored at −80ºC. Tissue was homogenized in Qiazol buffer (Qiagen) before total RNA isolation using the QiaGen RNeasy mini kit (Qiagen) and RNA was quantified using a Nanodrop 1000. RNA was reverse transcribed using MMLV‐RT (Invitrogen) and oligo‐dT primers (Invitrogen) and cDNA was stored at −20° C. qPCR was performed using SsoFast Probes Supermix (Bio‐Rad) with a corresponding cycler program using a CFX 96 qPCR system (Bio‐Rad). Primer‐probe set gene expression assays for the Htt intron 1 sequences were 347F‐431R‐371P and for spliced Htt were ‐19F‐ex2R‐ex2P as detailed in Table 2 . Housekeeping reference genes were Atp5b, Eif4a2, and Ubc (striatum and cerebellum) and Atp5b, Eif4a2, Canx, and Rpl13a (cortex) from Primer Design (Benn, Fox, & Bates, 2008 ). The level of intronic sequences was determined by normalizing to housekeeping genes. The relative levels of the spliced transcript was determined by the 2−ΔΔCt method (Benn et al., 2008 ).
4
Hydrogel-Mediated Bone Regeneration in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Radial segmental defects in 8–10-week-old male NSG mice (Jackson Lab) were treated with 4.5% hydrogels functionalized with 1.0 mM adhesive peptide and crosslinked with 75:25 VPM:DTT with 15k hMSC (n = 7–8). The tissue within the 2.5 mm defect space was explanted at 1 week post-transplantation and stored in RNAlater solution (Qiagen) until further processing. Samples were placed in Qiazol solution (Qiagen), lysed by probe sonication, and homogenized in QIAshredder columns (Qiagen). Total RNA was isolated using an RNAeasy Plus Micro kit (Qiagen), and RNA content and purity were measured by spectrophotometry (NanoDrop 1000). cDNA synthesis was performed on total RNA (100 ng) using the High-Capacity RNA-to-cDNA Kit (ThermoFisher).
5
FFPE RNA Fusion Analysis Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Cases 2 & 6—9, RNA was isolated from formalin-fixed paraffin embedded (FFPE) tissue sections using RNeasy FFPE Kit of Qiagen (Hilden, Germany) and quantified spectrophotometrically using NanoDrop-1000 (Waltham, United States). Molecular analysis for gene fusions was performed using the TruSight RNA Fusion panel (Illumina, Inc., San Diego, CA, USA) with 500 ng RNA as input according to the manufacturer`s protocol. Libraries were sequenced on a MiSeq (Illumina, Inc., San Diego, CA, USA) with > 3 million reads per case, and sequences were analyzed using the RNA-Seq Alignment workflow, version 2.0.1 (Illumina, Inc., San Diego, CA, USA). The Integrative Genomics Viewer (IGV), version 2.2.13 (Broad Institute, REF) was used for data visualization. Case 5 was tested for gene fusions and sequence variants using the method described recently [11 (link)].
6
Quantitative PCR Analysis of Gene Expression
7
RNA Sequencing of FFPE Tissue Samples
8
RNA Extraction and Immune Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from lysates of vaccine-stimulated PBMCs and CBMCs using the Qiagen RNeasy Minikit and DNAse treatment performed using the Qiagen RNAase Free DNAase set all per the manufacturer’s instructions. RNA concentrations were determined using the Nanodrop 1000 and cDNA generated using the Qiagen RT2 First Strand Kit. 96-well PCR array analysis was performed using the Qiagen standardized Innate and Adaptive Immune Reponses PCR Array (PAHS-0522A) and RT2 qPCR roxSYBR green kit. Web-based PCR array analyses (RT2 Profiler PCR Array Data Analysis version 3.5) was used and normalized to five reference genes (B2M, HPRT1, RPL13A, GAPDH, and ACTB). Relative quantification of gene expression was calculated by the ΔCt (relative expression × 104). Multivariate biplots of principal component analyses were performed in R 3.4.2 using ggplot2, ggord, and vegan packages using log-fold transcript abundance of gene arrays in each group. Genes were sorted using unsupervised hierarchical heatmap clustering of log-fold changes using the heatmap2 package.
9
HPV Detection and RNA Fusion Analysis in FFPE Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from formalin-fixed paraffin-embedded tumor tissue and tested for oncogenic Human Papillomavirus (HPV) infection using the methods described previously [5 (link)]. RNA was isolated from formalin-fixed paraffin embedded (FFPE) tissue sections using RNeasy FFPE Kit of Qiagen (Hilden, Germany) and quantified spectrophotometrically using NanoDrop-1000 (Waltham, United States). Molecular analysis was performed using the TruSight RNA Fusion panel (Illumina, Inc., San Diego, CA, USA) with 500 ng RNA as input according to the manufacturer`s protocol. Libraries were sequenced on a MiSeq (Illumina, Inc., San Diego, CA, USA) with > 3 million reads per case, and sequences were analyzed using the RNA-Seq Alignment workflow, version 2.0.1 (Illumina, Inc., San Diego, CA, USA). The Integrative Genomics Viewer (IGV), version 2.2.13 (Broad Institute, REF) was used for data visualization.
10
Quantitative Analysis of Huntingtin Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!