Nhlfs

Manufactured by Lonza

Sourced in United States

NHLFs are normal human lung fibroblasts, which are primary cells derived from the lungs of healthy adult donors. These cells are commonly used in cell culture research to study various aspects of lung biology and function.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Normal human lung fibroblasts (NHLFs) (13 citations) NHLF cells (3 citations) NHLF CC-2512 (3 citations) NHLF) cell line (2 citations)

26 protocols using nhlfs

Cell Culture Protocol for HUVECs and NHLFs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human umbilical vein endothelial cells
(HUVECs) and normal human lung fibroblasts (NHLFs) were purchased
from LONZA. HUVECs were cultured in an endothelial cell growth medium
supplemented with EGM-2 SingleQuot kit supply and growth factors (LONZA).
NHLFs were cultured in fibroblast growth basal medium supplemented
with FGM-2 BulletKit (LONZA). HCT-116 cell line was purchased from
ATCC. Dulbecco’s modified Eagle’s medium (DMEM, Life
Technology) was supplemented with 10% fetal bovine serum (FBS, Invitrogen)
and 1% antibiotic and antimycotic (ThermoFisher). All cells were cultured
at 37 °C in a humidified 5% CO₂ environment.

Wu Y., Zhao Y., Zhou Y., Islam K, & Liu Y. (2023). Microfluidic Droplet-Assisted Fabrication of Vessel-Supported Tumors for Preclinical Drug Discovery. ACS Applied Materials & Interfaces, 15(12), 15152-15161.

+ Open protocol

+ Expand

Isolation and Transfection of Primary Human Endothelial Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical cords obtained from local hospitals under the University of California, Irvine, Institutional Review Board approval and were cultured as previously described [4 (link)]. Normal human lung fibroblasts (NHLFs) were purchased from Lonza and cultured in M199 containing 10% FBS. Human cardiac microvascular endothelial cells (HMVECs) were purchased from Lonza and maintained similarly to HUVEC. The BALB/c colon carcinoma cell line CT26.WT (ATCC) was cultured in RPMI (Life Technologies) supplemented with 10% fetal bovine serum.
HUVEC were transfected with siRNA using Lipofectamine 2000 in Opti-MEM (Invitrogen). The sequences of the siRNA to human raptor and Rictor (Thermo Scientific) are as follows: Raptor 5′GGGAGAAGCUGGAUUAUUUUU3′ and Rictor 5′GGAAAUAAGGCGAGGUCUAUU3′. siRNA targeting Rheb and Sin1 were ON-TARGETplus siRNA from Thermo Scientific. A non-targeting scrambled control siRNA (Thermo Scientific) was used in all experiments to assess sequence independent effects of siRNA delivery. Transfection efficiency was determined by Western blot (see below).

Ziegler M.E., Hatch M.M., Wu N., Muawad S.A, & Hughes C.C. (2016). mTORC2 MEDIATES CXCL12-INDUCED ANGIOGENESIS. Angiogenesis, 19(3), 359-371.

+ Open protocol

+ Expand

Culturing Primary Human Lung Fibroblasts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

NHLFs were acquired from Lonza (Walkersville, MD) and cultured at sub-confluent densities in fibroblast growth medium which contained fibroblast basal medium with FGM2 BulletKit growth supplements (FGM2, Lonza) and 100 U/ml penicillin/streptomycin as previously described [53 (link)]. Briefly, cells were passaged by washing with a HEPES-based saline buffer, suspension via 0.025% trypsin/EDTA, and neutralization using trypsin neutralization solution (Lonza) following manufacturer’s procedures. Cells were maintained in a 37 °C incubator in a humid, 5% CO₂ atmosphere. 3rd–7th passage NHLFs were used for all assays.

Fraser K., Hubbs A., Yanamala N., Mercer R.R., Stueckle T.A., Jensen J., Eye T., Battelli L., Clingerman S., Fluharty K., Dodd T., Casuccio G., Bunker K., Lersch T.L., Kashon M.L., Orandle M., Dahm M., Schubauer-Berigan M.K., Kodali V, & Erdely A. (2021). Histopathology of the broad class of carbon nanotubes and nanofibers used or produced in U.S. facilities in a murine model. Particle and Fibre Toxicology, 18, 47.

+ Open protocol

+ Expand

Culturing Cell Types for Lung Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVECs were purchased from Lonza (cat. no. CC-2519) and maintained in EGM-2MV media (cat. no. CC-3202). NHLFs were purchased from Lonza (cat. no. CC-2512) and maintained in FGM-2 fibroblast growth media (cat. no. CC3132). Human tumor-associated fibroblasts derived from lung adenocarcinoma (cat. no. HC-6013A) or lung squamous cell carcinoma (cat. no. HC-6013S) were purchased from Cell Biologics and maintained in Fibroblast Medium (cat. no. M2267) supplemented with 5% v/v FBS on Collagen Type 1-coated (Corning; cat. no. 354236) 100 mm tissue culture plates.

Natesh N.R., Mogha P., Chen A., Antonia S.J, & Varghese S. (2024). Differential roles of normal and lung cancer-associated fibroblasts in microvascular network formation. APL Bioengineering, 8(1), 016120.

+ Open protocol

+ Expand

Cell Culture Protocols for Angiogenesis Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVECs and HMVECs (Lonza) were cultured in EGM-2 media (Lonza) supplemented with 10% fetal calf serum (Hyclone). NHLFs (Lonza) were cultured in FBM media (Lonza) supplemented with 10% fetal calf serum (Hyclone). 4T1 cells (American Type Culture Collection) were culture in McCoy’s media, Dulbecco’s modified Eagle’s medium, or RPMI-1640 supplemented with 10% fetal calf serum and antibiotics. Cells were tested and found negative for mycoplasma contamination before use in the assays described. Mirin-1 and Vandetanib were purchased from Cayman Chemical and Selleckchem, respectively. VEGF was purchased from PeproTech, Inc.

Espinosa-Diez C., Wilson R., Chatterjee N., Hudson C., Ruhl R., Hipfinger C., Helms E., Khan O.F., Anderson D.G, & Anand S. (2018). MicroRNA regulation of the MRN complex impacts DNA damage, cellular senescence, and angiogenic signaling. Cell Death & Disease, 9(6), 632.

+ Open protocol

+ Expand

Culturing HeLa and Primary Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic antimycotic solution (Sigma-Aldrich). Human primary cultured cells were expanded in the provided medium according to the manufacturer’s instructions. NHDFs (Lonza) and NHLFs (Lonza) were cultured with FBM-2 BulletKit containing 2% FBS (Lonza), neonatal NHEKs (Lonza) with KGM-Gold BulletKit (Lonza), and HREs (Lonza) with REGM BulletKit containing 0.5% serum (Lonza). MEFs (Lonza) were expanded in the same medium as HeLa cells. These primary cultured cells were used within 10 passages. hiPSCs derived from NHDFs (201B7) (36 (link)) were maintained with StemFit AK03N (AHS) on nippi iMatrix-511–coated well plates. Upon spontaneous differentiation (26 (link)), 3000 hiPSCs were seeded on iMatrix-511–coated six-well plates and cultured in StemFit AK03N without bFGF for 14 days. Cell culture without bFGF for 1, 3, and 6 or 9 days was started with 50,000, 10,000, and 3000 hiPSCs, respectively, on 24-well plates. The medium for hiPSCs was changed every second day.

Endo K., Hayashi K, & Saito H. (2019). Numerical operations in living cells by programmable RNA devices. Science Advances, 5(8), eaax0835.

+ Open protocol

+ Expand

Fibroblast Isolation and TGF-β1 Activation for IPF Modeling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal human lung fibroblasts (NHLFs, Lonza) were cultured in a Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Millipore), 2 mM L-glutamine (Gibco), and 1× antibiotic–antimycotic and used for experiment between passage 4 and 7. Cryopreserved patient derived fibroblasts, isolated as previously described,³² (link) were cultivated in the same medium and utilized in experiments between passages 2 and 4. We released all cell types with 0.05% trypsin-EDTA and neutralized trypsin with respective growth media, subculturing NHLFs at a ratio of 1:5 and dividing patient isolated fibroblasts 1:3. Fibroblasts were isolated from IPF patients receiving a lung transplant or from non-cancerous tissue adjacent to tumor resections (supplementary material, Table 1). All fibroblasts were cultured in an experimental culture media with reduced serum at a final concentration of 2% FBS. To simulate IPF in vitro with normal cells, we activated NHLFs with a single supplement of 2 ng/mL TGF-β1 24 h after tissue fabrication.

Cummins K.A., Bitterman P.B., Tschumperlin D.J, & Wood D.K. (2021). A scalable 3D tissue culture pipeline to enable functional therapeutic screening for pulmonary fibrosis. APL Bioengineering, 5(4), 046102.

+ Open protocol

+ Expand

Fibroblast Characterization and Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fibroblast basal medium, growth supplements, and NHLFs were purchased from Lonza (Walkersville, MD). Human-derived transforming growth factor beta (TGFβ), as well as the TGFβ receptor blocker SB431542, was obtained from R&D Systems, Inc. (Minneapolis, MN). Poly-L-lysine was purchased from Sigma-Aldrich (St. Louis, MO). The anti-Collagen I antibody was purchased from Fitzgerald (Acton, MA), while the alpha tubulin antibody was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX). Alexa-fluor 488-conjugated donkey anti-rabbit secondary antibody, alexa-fluor 488-conjugated alpha-smooth muscle actin (α-SMA) primary antibody, and the beta actin primary antibody were purchased from Abcam (Cambridge, MA). ProLong gold antifade with DAPI mountant was obtained from Molecular Probes (Thermo Fisher Scientific, Waltham, MA).

Davidson D.C., Derk R., He X., Stueckle T.A., Cohen J., Pirela S.V., Demokritou P., Rojanasakul Y, & Wang L. (2016). Direct stimulation of human fibroblasts by nCeO2in vitro is attenuated with an amorphous silica coating. Particle and Fibre Toxicology, 13, 23.

+ Open protocol

+ Expand

Coculturing Endothelial Cells and Fibroblasts for Vascular Network Formation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human endothelial colony forming cell-derived endothelial cells (ECFC-ECs) were isolated from cord blood as previously described^{29 (link)} and expanded in gelatin-coated (0.5%) flasks in EGM-2 medium (Lonza). ECs were transduced with lentivirus constructs (Addgene) to express mCherry fluorescent protein and used once they reached passage 4–7. Normal human lung fibroblasts (NHLFs) were purchased from Lonza, cultured in DMEM (Corning) containing 10% fetal bovine serum (FBS, Gemini Bio Products), and used once they reached passage 4–7. All cell types were grown in a 37 °C/5% CO₂/20% O₂ incubator in 100% humidified air before use in experiments. Here, the fibroblasts served as pericytes in the coculture system. Fibroblasts can stabilize and promote the maturation of networks in microfluidic devices. The soluble protein secreted by fibroblasts supported not only EC sprouting but also lumen formation of the vascular networks. Fibroblast-derived proteins also increased the stiffness of the ECM, thus partially inducing lumen formation by ECs. Furthermore, fibroblasts can secrete a variety of angiogenic growth factors during tissue growth^{30 (link),31 (link)}.

Yue T., Zhao D., Phan D.T., Wang X., Park J.J., Biviji Z., Hughes C.C, & Lee A.P. (2021). A modular microfluidic system based on a multilayered configuration to generate large-scale perfusable microvascular networks. Microsystems & Nanoengineering, 7, 4.

+ Open protocol

+ Expand

Isolation and Culture of Human Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human umbilical vein endothelial cells (HUVECs) were harvested from fresh umbilical cords following a previously established protocol (Ghajar et al., 2006 (link)). HUVECs were plated with endothelial growth media (EGM-2, Lonza, Walkersville, MD) in tissue culture flasks and cultured at 37 °C and 5% CO₂. Media were changed every 48 hours and cells were used at passage 3. Normal human lung fibroblasts (NHLFs, Lonza) were cultured at 37 °C and 5% CO₂ in Dulbecco’s modified eagle media (DMEM, Life Technologies, Grand Island, NY) with 10% fetal bovine serum (FBS). Culture media were replaced every 48 hours and cells from passage 6–10 were used in experiments. iCell endothelial cells (Cellular Dynamics International, Madison, WI), referred to as iPSC-ECs, were cultured at 37 °C and 5% CO₂ in Vasculife VEGF endothelial medium (Lifeline Cell Technology, Fredrick, MD) supplemented with iCell Endothelial Cell Medium Supplement (Cellular Dynamics International), per the manufacturer’s instructions. iPSC-EC’s tissue culture flasks were coated with 35 μg/mL fibronectin (Invitrogen, Carlsbad, CA) for 1 hr at room temperature prior to plating the cells. Culture media were replaced every 48 hours and cells from passage 3 were used in experiments.

Bezenah J.R., Rioja A.Y., Juliar B., Friend N, & Putnam A.J. (2018). Assessing the ability of human endothelial cells derived from induced pluripotent stem cells to form functional microvasculature in vivo. Biotechnology and bioengineering, 116(2), 415-426.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!