Sigenome library

A siGENOME library (Dharmacon, Lafayette, CO, USA) containing a pool of 4 distinct siRNA duplexes (6.25 pmol) in each well that target a specific candidate gene or in separate wells, positive and negative controls [6 (link),7 (link)], was employed in the scQuantIM screen. Standard reverse transfection with DharmaFECT 2 transfection reagent (Dharmacon, Lafayette, CO, USA) was performed according to manufacturer’s instructions. Cells were seeded, allowed to grow for 4 (HCT116) to 6 days (hTERT) at 37 °C, fixed (4% paraformaldehyde) and counter-stained (Hoechst 33342) to visualize nuclei [7 (link)]. Subsequent direct tests employed ON-TARGETplus siRNA duplexes (Dharmacon, Lafayette, CO, USA) in a pooled format as detailed elsewhere [6 (link)]. Gene silencing was confirmed by Western blot 4 days post-transfection as described [23 (link)]. Membranes were blotted with the primary antibody at the indicated dilutions (Table 1) and visualized using secondary antibodies conjugated to horseradish peroxidase. Blots were imaged on a MyECL Imager (Thermo Scientific, Mississauga, ON, Canada) using standard chemiluminescence.

A small interfering RNA (siRNA) duplex targeted against mouse Keap1 and a scrambled, nontargeting control duplex (D-001210-03) were purchased from the Dharmacon siGENOME library. Cells were transfected for 48 h with 10 nM siRNA using Lipofectamine RNAiMAX (Life Technologies), according to the manufacturer׳s instructions.

Sequences of the siRNA oligos targeting RNF26 were obtained from Dharmacon (siGenome library) (siRNF26‐1: CAGGAGGGAUAACCGGAUUUU; siRNF26‐2: GAGAGGAUGUCAUGCGGCU, siHERP1 pool of 4 siRNAs). Gene silencing was performed in a 48‐ or 24‐well plate (IF) or 12‐well plate (WB)—reagent volumes were scaled up accordingly. In a 24‐well plate, 65 μl siRNA [50 nM] was mixed with 26 μl 1× siRNA buffer (GE Healthcare) containing 1.15 μl Dharmafect 1 transfection reagent. The mix was incubated on a shaker at RT for 30 min before the addition of 18,000 HeLa or 30,000 U2OS cells (and coverslips). Cells were cultured for 3 days before analysis. Nontargeting siRNA or reagent‐only was used as a negative control.