Total RNA was isolated from the cells using the TRIzol reagent (Life Technologies). For the synthesis of cDNA, RT reactions were performed by incubating 200 ng of total RNA with a reaction mixture containing 0.5 μg/μL oligo dT12–18 and 200 U/μL moloney murine leukemia virus RT (Life Technologies). Real-time RT-PCR was carried out using a Roche Light Cycler (Mannheim, Germany) with the Takara SYBR Premix ExTaq System for relative quantification. Primers were synthesized by Bioneer (Daejeon, Republic of Korea) and primer sequences for the human genes are described in our previous studies [56 (link), 57 (link)]. PCR primers for CD44 are 5′-AGCAGCACTTCAGGAGGTTAC-3′ and 5′-TGCCTCTTGGTTGCTGTCTC-3′.
Moloney murine leukemia virus rt
Manufactured by Thermo Fisher Scientific
The Moloney murine leukemia virus RT is a reverse transcriptase enzyme derived from the Moloney murine leukemia virus. It is used for the synthesis of complementary DNA (cDNA) from RNA templates in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq system, by Takara Bio (3 mentions)
Lightcycler, by Takara Bio (2 mentions)
Faststart dna master sybr green, by Roche (2 mentions)
Lightcycler apparatus, by Roche (2 mentions)
Oligo dt 12 18, by Thermo Fisher Scientific (1 mentions)
Lightcycler, by Roche (1 mentions)
Gel doc ez imager, by Bio-Rad (1 mentions)
Thermal cycler, by Bio-Rad (1 mentions)
Lightcycler 480 sybr green 1 master kit, by Roche (1 mentions)
Gel doc xr gel documentation system, by Bio-Rad (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Lc480 pcr system, by Roche (1 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Quantity one 4, by Bio-Rad (1 mentions)
Rnase free dnase 1, by Roche (1 mentions)
12 protocols using moloney murine leukemia virus rt
1
Quantitative RT-PCR Analysis of CD44 Expression
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the seeded cells using TRIzol reagent (Thermo Fisher Scientific Inc.). For cDNA synthesis, RT reactions were performed by incubating 200 ng of the total RNA with a reaction mixture, which contained 0.5 µg/µL oligo dT12-18 and 200 U/μL Moloney murine leukemia virus RT (Life Technologies). Real-time PCR was performed using a Roche Light Cycler (Mannheim, Germany) with the Takara SYBR Premix ExTaq System (Takara Bio Inc.) (Ryu et al., 2020 (link)). Primers were synthesized by the Bioneer Corporation (Daejeon, Korea), and the primer sequences for the human NRF2, AKR1C1, CD44, MDR1, HAS1-3 and hypoxanthine phosphoribosyltransferase-1 (HPRT1) are as follows: NRF2, 5’-ATAGCTGAGCCCAGTATC-3’ and 5’-CATGCACGTGAGTGCTCT-3’; AKR1C1, 5’-CGAGAAGAACCATGGGTGGA-3’ and 5’-GGCCACAAAGGACTGGGTCC-3’; CD44, 5’- CGGACACCATGGACAAGTTT-3’ and 5’- GAAAGCCTTGCAGAGGTCAG-3’; MDR1, 5’-CTATGCTGGATGTTTCCGGT-3’ and 5’-TCTTCACCTGGCTCAGT’-3’; HAS1, 5’-TACTTTTGGGGATGACCGGC-3’ and 5’-AAGTACGACTTGGACCAGCG-3’; HAS2, 5’-CCATGGTTGGAGGTGTTGGG-3’ and 5’-CTGTACATTCCCAGAGGTCCAC-3’; HAS3, 5’-GCGATTCGGTGGACTACATC-3’ and 5’-CGTACTTGTTGAGGATCTGGAC-3’; HPRT1, 5’-TGGCGTCGTGATTAGTGATG-3’ and 5’-GCTACAATGTGATGGCCTCC-3’.
3
Comprehensive RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using the TRIzol reagent (Life Technologies). For the synthesis of cDNA, RT reactions were performed by incubating 200 ng of total RNA with a reaction mixture containing 0.5 μg/μL oligo dT12–18 and 200 U/μL moloney murine leukemia virus RT (Life Technologies). Real-time RT-PCR was carried out using a Roche Light Cycler (Mannheim, Germany) with the Takara SYBR Premix ExTaq System for relative quantification. Primers were synthesized by Bioneer (Daejeon, Republic of Korea) and primer sequences for the human genes are described in our previous studies [29] (link), [36] (link) . For CD44 isoforms amplification, PCR was carried out with a thermal cycler (Bio-Rad, Hercules, CA, USA) and PCR products were resolved on 3% agarose gels and the images were captured by using a Gel Doc EZ Imager (Bio-Rad). PCR primers for CD44 isoforms are as follows: CD44 5′- CGGACACCATGGACAAGTTT-3′ and 5′- GAAAGCCTTGCAGAGGTCAG-3′; CD44s 5′-AGCAGCGGCTCCTCCAGTGA-3′ and 5′- CCCACTGGGGTGGAATGTGTCT-3′; CD44v3 5′-GCACTTCAGGAGGAGGTTACATC-3′ and 5′-CTGAGGTGTCTGTCTCTTTC-3′; CD44v8-10 5′-TCCCAGACGAAGACAGTCCCTGGAT-3′ and 5′-CACTGGGGTGGAATGTGTCTTGGTC -3′.
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from kidneys, as described by Chomczynski and Sacchi, 31 and quantified by a photometer. One microgram of the resulting RNA was used for reverse transcription. The cDNA was synthesized by Moloney murine leukemia virus RT (Life Technologies, Carlsbad, CA). For quantification of mRNA expression, real-time PCR was performed using a Light Cycler Instrument and the LightCycler 480 SYBR Green I Master Kit (Roche Diagnostics, Indianapolis, IN) and ribosomal protein L32 as a control. Table 1 lists the primer sequences.
5
RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocols used for RT-PCR were described previously (33 (link)). Briefly, total RNA was isolated from harvested cells and DNase I treated using the RNeasy kit (Qiagen). The cDNAs were synthesized using random primers and Moloney murine leukemia virus RT (Invitrogen). The RT-PCR products were separated on a 2% w/v agarose-TBE gel, stained with ethidium bromide, and visualized using a Gel Doc XR+ gel documentation system (Bio-Rad). The band intensities of three technical replicates were quantified and background corrected using ImageJ (66 ) and are representative of multiple biological replicates. The primer sequences are listed in Table S3 .
6
Quantification of Gene Transcripts
7
Quantifying mRNA Levels via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs (2 µg) were reverse-transcribed with Moloney murine leukemia virus RT (Invitrogen) using random hexanucleotides. Real-time quantitative PCR was done using the “FastStart DNA Master SYBR Green” kit and the Lightcycler apparatus (Roche Diagnostic). The mRNA levels of interest were normalized to the 18S RNA amount, which was not affected by the different fasting periods (in the liver) and the pyruvate treatment (in the hepatocytes).
8
Quantitative Analysis of Immune Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from sorted cells according to the manufacturer’s protocol for TRIzol (Invitrogen Life Technologies). Moloney murine leukemia virus RT (Invitrogen Life Technologies) was used to synthesize cDNA from the total RNA using random hexamer primers. Quantitative Real-Time Reverse Transcriptase- PCR assays (qRT-PCR) for IFN-γ, IL-17, T-bet, ROR-γt, and 18S rRNA (Applied Biosystems) were performed using ABI Prism 7300 Sequence Detection Systems (Applied Biosystems, Foster City, CA). The following primer and probe sequences were used: IFN-γ (Forward CATTGAAAGCCTAGA AAGTCTGAATAAC, Reverse TGGCTCTGCAGGATTTTCATG, Probe TCACCATCCTTTTGCCAGTTCCTCCAGMGB), IL-17 (Forward CTCCAGAAGGCCCTCAGACTAC, Reverse TGTGGT GGTCCAGCTTTCC, Probe ACTCTCCACCGCAATGAMGB), ROR-γt (Forward CCGCTGAGAGGGCTTCAC, Reverse TGCA GGAGTAGGCCACATTACA, Probe AAGGGCTTCTTCCGCC GCAGCCAGCAG TAMRA). The expression of T-bet and GM-CSF was determined using Mm01299452-g1- and Mm00438328-m1 TaqMan gene expression assays (Applied Biosystem), respectively. Relative RNA levels in the samples were determined using standard curves prepared from four-fold serial dilutions of cDNA from a reference sample. Relative expression levels of genes were normalized to 18S rRNA in the samples.
9
Liver RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction of liver and quantitative real-time PCR were conducted as previously described9 (link). For microRNA quantification, cDNA was synthesized with Moloney murine leukemia virus RT (Invitrogen) according to the manufacturer’s recommendations, and the mRNA level was normalized to U6. The mRNA levels were determined using the △△CT method and expressed as a fold of the control group.
10
Quantifying RAR beta2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs (2 µg) were reverse transcribed with Moloney murine leukemia virus RT (Invitrogen) using random hexanucleotides. Real-time qPCR (denaturation at 95 °C for 10 s, annealing at 65 °C for 15 s, elongation at 72 °C for 15 s) was done using the “FastStart DNA Master SYBR Green” kit and the LightCycler apparatus (Roche Diagnostics). The RARβ2 mRNA expression represents the ratio between values obtained from treated and untreated cells normalized to 18S RNA. The primer sequences are given in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!