Immunized mice were sacrificed 14 days after immunization and draining lymph nodes (cervical lymph node) and non-draining lymph nodes (inguinal lymph node) were dissected. Lymph nodes were digested with 1 mg/ml collagenase D (ThermoFisher Scientific, USA) and 10 µg/ml DNAse I (ThermoFisher Scientific, USA) in 2 ml HBSS at 37°C for 40 min. Digestion was stopped by adding 15 ml of a PBS-BSA 1% plus 5 mM EDTA solution and digested lymph nodes were passed through a 70 µm cell strainer. The total number of cells obtained after lymph node digestion and cell subgroup were analyzed by flow cytometry with the following antibodies: anti-CD4 Percp (1:200), anti-CD8 PE (1:100), and anti-IgD fitc (1:100) (ThermoFisher Scientific, USA).
Anti cd4 percp
Manufactured by Thermo Fisher Scientific
Sourced in United States
Anti-CD4-PerCP is a fluorescently-labeled antibody that binds to the CD4 receptor on T helper cells. It is designed for use in flow cytometry applications to identify and quantify CD4+ T cells within a sample.
Automatically generated - may contain errors
Lab products found in correlation
Anti cd3 fitc, by Thermo Fisher Scientific (3 mentions)
Anti gata3 pe, by Thermo Fisher Scientific (3 mentions)
Anti tbet apc, by Thermo Fisher Scientific (3 mentions)
Cflow sampler software, by BD (3 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Anti b220 apc, by Thermo Fisher Scientific (2 mentions)
Anti cd138 pe, by Thermo Fisher Scientific (2 mentions)
Anti gl7 fitc, by Thermo Fisher Scientific (2 mentions)
Anti cd3 cd28 antibody, by Thermo Fisher Scientific (2 mentions)
Nylon cell strainer, by BD (2 mentions)
Accuri, by BD (2 mentions)
Lsm 510 meta, by Zeiss (2 mentions)
Anti cd8 pe, by Thermo Fisher Scientific (1 mentions)
Collagenase d, by Thermo Fisher Scientific (1 mentions)
Anti cd11c pe, by Thermo Fisher Scientific (1 mentions)
Facsaria 2 cell sorter, by BD (1 mentions)
Anti il 10 apc, by Thermo Fisher Scientific (1 mentions)
Anti cd23 pe cy7, by Thermo Fisher Scientific (1 mentions)
Anti cd8 pe cy7, by Thermo Fisher Scientific (1 mentions)
Lps e coli o111 b4, by Merck Group (1 mentions)
11 protocols using anti cd4 percp
1
Lymph Node Immune Cell Analysis
2
Isolation and Adoptive Transfer of Antigen-Specific CD4+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovalbumin-specific CD4+ T cells were isolated from BALB/c DO11.10 mice. Briefly, the spleens of BALB/c DO11.10 mice were removed and cell suspensions were obtained as described below. The splenocytes were incubated with anti-CD3-APC.Cy7 (clone: 145.2C11), anti-CD4-PerCP (clone: RM 4–5) and anti-CD11c-PE (clone: N418), as well as green fluorescence Live/Dead (Thermo Fisher Scientific), for 30 min on ice in the dark. All antibodies were obtained from BD Biosciences. After two washes with FACS buffer (1X PBS and 2% of Fetal Bovine Serum), live CD11c−CD3+CD4+ cells were sorted using a FACSAria™ II Cell Sorter (BD Biosciences) with more than 90% of purity. Three million DO11.10 CD4+ T cells were adoptively transferred to WT or STAT6 KO mice by intravenous route 24 h before the immunization.
3
Flow Cytometric Analysis of B Cell Populations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flow cytometric analysis of B cell populations was performed using our previously described gating strategies8 (link)15 (link)16 (link)17 (link). Following red cell lysis, cells were counted and stained with a cocktail of antibodies for the detection of the indicated populations using anti-CD19-AF700, anti-CD23-PE/Cy7, anti-CD21-E450, anti-CD43-PE/Cy7, anti-GL7-FITC, anti-CD138-PE, anti-B220-E450, anti-B220-APC, anti-IL-10-APC, anti-CD3-FITC, anti-CD4-PerCP and anti-CD8-PE/Cy7 antibodies from eBioscience and Biolegend. Plasma cells were phenotyped as (Dump (CD3, CD4, CD8, CD11b, GR1 & CD11c)− CD138+CD19−B220−) with the Dump+ markers identified using biotinylated antibodies and svPE. Alternatively, splenocytes were stimulated with 50 ng/ml PMA (Sigma-Aldrich, UK) plus 500 ng/ml ionomycin (Sigma-Aldrich, UK) and 10 μg/ml LPS (E. coli O111:B4, Sigma-Aldrich, UK) for 1 h before addition of 10 μg/ml Brefeldin A (Sigma-Aldrich, UK) and cells were then incubated for a further 5 h at 37 °C with 5% CO2. Cells were fixed and washed several times in permeabilization buffer before anti-IL-10 was added in permeabilization buffer and incubated at 4 °C for 30 minutes. Cells were then washed three times with permeabilization buffer and finally with FACs staining buffer before data were acquired using a BD LSR II flow cytometer and analysis undertaken by FlowJo software (TreeStar).
4
Th17 Cell Differentiation and SNP Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Naive CD4+ T cells were purified from spleens of CB6F1 mice using anti‐CD4 microbeads (Miltenyi Biotech, Auburn, CA, USA) then stained with anti‐CD4‐PerCP, anti‐CD62L‐APC, and anti‐CD44‐PE antibodies (eBioscience‐ThermoFisher, Waltham, MA, USA). CD4+CD62LhighCD44low T cells were sorted using a BD FACSAria cell sorter. Th17 cells were differentiated on plates coated with anti‐CD3 (2 µg ml−1) and anti‐CD28 (2 µg ml−1), in the presence of 2 ng ml−1 rhTGF‐β1, 25 ng ml−1 rmIL‐6 and, 20 ng ml−1rmIL‐23. RNA was extracted after 72 h using RNeasy mini KIT (Qiagen, Hilden, Germany) and reverse transcribed with High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems‐ThermoFisher, Waltham, MA, USA). A sequence fragment containing SNP rs48924577 was amplified using primers 5′‐CGCCCTTCCATGCCTTAGC‐3′ and 5′‐ CTCCAGAGCTGCACTTCTCA‐3′. Purified PCR products were sequenced by MiSeq (Illumina, San Diego, CA, USA).
5
Multicolor Flow Cytometry of Mouse Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly isolated liver MNCs and spleen cells were initially incubated with anti-mouse CD16/32 (1:100 final dilution; Becton Dickinson) for 15 minutes at room temperature. The washed cells were incubated for 30 minutes at 4 °C with the following fluorescently labeled monoclonal antibodies: anti-ST2L-PE (eBioscience, San Diego, CA), anti-CD11b-APC (eBioscience), anti-CD19-PE-Cy7 (eBioscience), anti-CD4-PerCP (eBioscience), anti-CD3-APC (BD Pharmingen, San Diego, CA), anti-F4/80-FITC (eBioscience), anti-F4/80-PerCP-Cy5.5 (eBioscience), anti-MHCII-FITC (eBioscience). FACS analysis was performed using FACScalibur and/or FACSverse (both from Becton Dickinson).
6
Isolation and Characterization of Murine Mononuclear Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mononuclear cells were isolated from spleens and mesenteric lymphoid nodes (MLN) by gentle extrusion of the tissue through a 50 µm-mesh Nylon cell strainer (BD Biosciences, San Jose, CA, USA) and subsequent lysis of erythrocytes in red blood cell lysing buffer (Sigma-Aldrich) as previously described [52 (link)].
For flow cytometry analysis, aliquots of 106–107 cells per sample were pre-incubated with purified anti-mouse CD16/CD32 (eBioscience, San Diego, CA, USA) and then labelled with anti-CD3-FITC, anti-CD4-PerCP, anti-Tbet-APC and anti-Gata3-PE (all from eBioscience) according to the manufacturer’s instructions. Intracellular staining was performed with the FoxP3 Staining kit (eBioscience). Stained cells were analysed by flow cytometry (Accuri, Ann Arbor, MI, USA) with CFlowSampler software (BD Accuri, Ann Arbor, MI, USA).
For stimulation experiments, 2 × 105 cells isolated from spleens or MLN were cultured for 48 h (37 °C, 10% CO2) in DMEM medium in P24 plates pre-coated with anti-CD3/CD28 antibodies (4 µg/mL each; eBioscience) or phorbol 12-myristate 13-acetate (PMA)/ionomycin (cell stimulation cocktail, 1×, ebioscience). Culture supernatant was frozen at −80 °C until processing and cytokine concentration determined by a cytometric bead array system (Mouse Th1/Th2/Th17/Th22 13plex Flowcytomix) (eBioscience) according to the manufacturer’s instructions.
For flow cytometry analysis, aliquots of 106–107 cells per sample were pre-incubated with purified anti-mouse CD16/CD32 (eBioscience, San Diego, CA, USA) and then labelled with anti-CD3-FITC, anti-CD4-PerCP, anti-Tbet-APC and anti-Gata3-PE (all from eBioscience) according to the manufacturer’s instructions. Intracellular staining was performed with the FoxP3 Staining kit (eBioscience). Stained cells were analysed by flow cytometry (Accuri, Ann Arbor, MI, USA) with CFlowSampler software (BD Accuri, Ann Arbor, MI, USA).
For stimulation experiments, 2 × 105 cells isolated from spleens or MLN were cultured for 48 h (37 °C, 10% CO2) in DMEM medium in P24 plates pre-coated with anti-CD3/CD28 antibodies (4 µg/mL each; eBioscience) or phorbol 12-myristate 13-acetate (PMA)/ionomycin (cell stimulation cocktail, 1×, ebioscience). Culture supernatant was frozen at −80 °C until processing and cytokine concentration determined by a cytometric bead array system (Mouse Th1/Th2/Th17/Th22 13plex Flowcytomix) (eBioscience) according to the manufacturer’s instructions.
7
Immunophenotyping of Myla2000, Hut78 Cells and Mice
8
Isolation and Flow Cytometric Analysis of Mesenteric Lymphoid Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mesenteric lymphoid nods (MLN) were gently extruded through a 50 μm-mesh Nylon cell strainer (BD) to isolate mononuclear cells. Then, cells were suspended in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% of FBS, 2 mM l -glutamine, 50 U/mg penicillin, and 50 µ/mg streptomycin (Lonza, Levallois-Perret, France). For flow cytometry analysis, aliquots of 106–107 cells per sample were labelled with anti-CD3-FICT, anti-CD4-PerCP, anti-Tbet-APC and anti-Gata3-PE according to the manufacturer’s instruction (eBioscience). The cells were analyzed using flow cytometry (Accuri, BD) and CFlow Sampler software (BD Biosciences) as described previously30 (link).
9
Naïve T cell differentiation assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Naïve T cells (CD44lowCD62LhighCD25−) were isolated from WT mice, and sorted naïve T cells were co-cultured with rAc-PF pre-treated BMDCs at naïve T cell:BMDCs ratio of 5:1 for 72 h at 37 °C in presence of an anti-CD3 antibody (eBioscience, San Diego, CA, USA). After co-culture, naïve T cells were stained with anti-CD4-PerCP (eBioscience) according to the protocol of manufacturer, fixed, permeabilized, and stained intracellularly with anti-mouse IL-4-PE-Cy7 and anti-mouse IL-17A-PE. Flow cytometry was performed using a FACS Canto II cytometer (BD Biosciences) equipped with Canto software.
10
Flow Cytometric Analysis of Murine Lymphocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We obtained mononuclear cells via the gentle extrusion of tissue from the spleen and the mesenteric lymph nodes (MLNs); the cells were analyzed using flow cytometry (Accuri, BD) and CFlow Sampler software (BD Biosciences) as described previously37 (link). Briefly, 1 × 106–107 cells were labeled with anti-CD3 FITC, anti-CD4 PerCP, anti-T-bet APC, and anti-GATA3-PE (all from eBioscience).
We performed stimulation experiments in which 2 × 105 cells per well were stimulated with anti-CD3/CD28 antibodies (eBioscience, San Diego, USA) as described previously37 (link). We determined supernatant cytokine concentrations using a cytometric bead array system (Mouse Th1/Th2/Th17/Th22 13-Plex FlowCytomix Multiplex; eBioscience) in accordance with the manufacturer’s instructions.
We performed stimulation experiments in which 2 × 105 cells per well were stimulated with anti-CD3/CD28 antibodies (eBioscience, San Diego, USA) as described previously37 (link). We determined supernatant cytokine concentrations using a cytometric bead array system (Mouse Th1/Th2/Th17/Th22 13-Plex FlowCytomix Multiplex; eBioscience) in accordance with the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!