Log In Sign up
The largest database of trusted experimental protocols

Ab177178

Manufactured by Abcam
Visit Supplier
Sourced in China

Ab177178 is a laboratory equipment product. It serves a core function within the scientific research process. Detailed information about its specific intended use or capabilities is not available at this time.

Automatically generated - may contain errors

Lab products found in correlation

Ab6002, by Abcam (4 mentions) Ab176877, by Abcam (3 mentions) Ab32129, by Abcam (2 mentions) Ab9050, by Abcam (2 mentions) Ab8580, by Abcam (2 mentions) Ab8898, by Abcam (2 mentions) Ez magna chip kit, by Merck Group (2 mentions) Ab171870, by Abcam (2 mentions) Anti h3k27me3, by Cell Signaling Technology (2 mentions) Ab4648, by Abcam (2 mentions) Ab7260, by Abcam (2 mentions) Chromatin immunoprecipitation kit, by Wanlei (2 mentions) Chip kit, by Wanlei (2 mentions) A2363, by ABclonal (1 mentions) Ab4729, by Abcam (1 mentions) Ab192985, by Abcam (1 mentions) Qiaquick spin column, by Qiagen (1 mentions) Qubit fluorometer, by Agilent Technologies (1 mentions) Ab8895, by Abcam (1 mentions) Agilent bioanalyzer 2100 system, by Agilent Technologies (1 mentions)

24 protocols using ab177178

1

Chromatin Immunoprecipitation (ChIP) Sequencing of Castor Bean

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP experiments and analyses were performed according to our previous study [78 (link)]. Briefly, young leaves and endosperm (35 DAP, at the fast oil accumulation stage) of castor bean were cross-linked in 1% formaldehyde and the reaction was terminated by adding 0.125 M glycine. Subsequently, the chromatin was extracted from isolated cell nuclei and sonicated to less than 500 bp. Immunoprecipitation was conducted using antibodies specific for five histone modifications: H3K4me3 (07-473; Millipore, Billerica, MA, USA), H3K36me3 (ab9050; abcam, Cambs, UK), H3K9ac (ab32129; abcam, Cambs, UK), H3K27ac (ab177178; abcam, Cambs, UK), and H3K27me3 (a2363; ABclonal, Wuhan, HB, CHN). After immunoprecipitation, genomic DNA was end-repaired, ligated to adapters, and sequenced on a BGISEQ-500 platform (BGI, BJ, CHN).
For ChIP sequencing data, adapter and low-quality reads were trimmed first. Then, the remaining clean reads were mapped to the castor bean reference genome (http://oilplants.iflora.cn/) using bowtie2 (version 2.3.2, [79 (link)]). MACS2 software (version 2.2.7) was employed to define peaks in leaf and endosperm samples. Peaks exhibiting differences in binding between leaf and endosperm samples were identified by MAnorm [80 (link)]. All assays were performed on two biological replicates.
Han B., Wu D., Zhang Y., Li D.Z., Xu W, & Liu A. (2022). Epigenetic regulation of seed-specific gene expression by DNA methylation valleys in castor bean. BMC Biology, 20, 57.
+ Open protocol
+ Expand
2

Mycoplasma-Free Cell Lines for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human kidney cancer cell lines 786-O and ACHN and the human embryonic kidney cell line HEK293T were routinely tested to confirm that they were mycoplasma-free. Cell lines were maintained in DMEM (HyClone) at 37°C with 5% CO2. Cultures were coated with 10% fetal bovine serum (FBS, HyClone) and 1% penicillin/streptomycin (HyClone). All cells used were expanded less than 6 months after resuscitation. The primary antibodies were anti-H3K27ac (ab177178, Abcam), anti-H3K4me1 (A2355, Abclonal), mouse monoclonal anti-FBP1 (DF7F25, Affinity) and anti-beta-actin (AF7018, Affinity) antibodies; secondary antibodies against mouse and rabbit IgG were purchased from Santa Cruz Biotechnology.
Ju D., Liang Y., Hou G., Zheng W., Zhang G., Dun X., Wei D., Yan F., Zhang L., Lai D., Yuan J., Zheng Y., Wang F., Meng P., Wang Y., Yu W, & Yuan J. (2022). FBP1 /miR-24-1/enhancer axis activation blocks renal cell carcinoma progression via Warburg effect. Frontiers in Oncology, 12, 928373.
+ Open protocol
+ Expand
3

ChIP-qPCR Analysis of H3K27ac and BRD4

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP assay was performed as reported previously (Song et al., 2020 (link)). Anti-H3K27ac antibody was purchased from Abcam (ab177178). Anti-BRD4 antibody was purchased from Bethyl Laboratories (A301-985A100). The purified DNA was analyzed by qPCR. The primer sequences used were listed below: CCT3-H3K27ac-CHIP-F: GCC​TCT​CTA​GTC​CAC​CTG​TTG, R: ACT​GTG​TAT​TGC​GAC​TCG​GC.
Ma J., Song P., Liu X., Ma C., Zheng M., Ren X., Wang R., Liu W., Lu Z, & Li J. (2022). Insights into the roles and driving forces of CCT3 in human tumors. Frontiers in Pharmacology, 13, 1005855.
+ Open protocol
+ Expand
4

Single-cell histone data antibody validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used in this study include H3K27ac (Abcam, ab177178, recombinant; Abcam, ab4729, polyclonal) and H3K27me3 (Abcam, ab192985, recombinant). We found that antibody specificity is critical for high-quality signals of single-cell histone data. For H3K27ac, although the recombinant antibody yielded a higher fragment number per cell than the polyclonal antibody, its enrichment at TSSs or ChIP–seq peaks was lower (Extended Data Fig. 6e). Therefore, except for replicate 1 of the mouse frontal cortex dataset, all other experiments targeting H3K27ac were performed with the polyclonal antibody. One microgram of antibody was used per Droplet Paired-Tag reaction.
Xie Y., Zhu C., Wang Z., Tastemel M., Chang L., Li Y.E, & Ren B. (2023). Droplet-based single-cell joint profiling of histone modifications and transcriptomes. Nature Structural & Molecular Biology, 30(10), 1428-1433.
+ Open protocol
+ Expand
5

ChIP-seq Protocol for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were cut into 2–3 mm 3 pieces, fixed in 1.5% formaldehyde for 10 min, and quenched with glycine. The tissues were mechanically extracted by applying 50–75 strokes using a Dounce homogenizer (Type B). Chromatin was sheared to 200–500 bp using a high-power Bioruptor Plus sonicator for 30 cycles (10 s ON, 10 s OFF). For each ChIP, 1–3 μg of antibodies were conjugated with 100 μL Protein G Dynabeads (Thermo Fisher Scientific, Cat. No. 10004D, 5 mL). Antibodies against the histone marks H3K4me3 (ab8580, Abcam), H3K4me1 (ab8895, Abcam), H3K9me3 (ab8898, Abcam), H3K36me3 (ab9050, Abcam), H3K27ac (ab177178, Abcam), and H3K27me3 (Cat. No: 39155, Active Motif) were used for immunoprecipitation. The immunoprecipitated and input DNA was purified with QIAquick Spin Columns (QIAGEN) and then subjected to library preparation using the ThruPLEX DNA-seq 48D Kit (Rubicon Genomics) according to the manufacturer’s instructions. The libraries were inspected with a Qubit fluorometer, Agilent Bioanalyzer 2100 system, and StepOnePlus Real-Time PCR.
Wang T., Song J., Qu M., Gao X., Zhang W., Wang Z., Zhao L., Wang Y., Li B., Li J, & Yang J. (2021). Integrative Epigenome Map of the Normal Human Prostate Provides Insights Into Prostate Cancer Predisposition. Frontiers in Cell and Developmental Biology, 9, 723676.
+ Open protocol
+ Expand
6

ChIP-seq protocol for ESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was done according to a published protocol (30 (link)). Approximately, 2 × 107 ESCs were harvested for ChIP. Briefly, ESCs were cross-linked with 1% (w/v) formaldehyde for 10 min at room temperature and quenched in 200  mM glycine. Cells were washed with chilled tris-buffered saline (TBS) containing EDTA, scraped off the plates and collected by centrifugation. The collected cell pellet was lysed in buffer containing 0.25% Triton X-100 and protease inhibitors. Subsequently, chromatin pellet was collected and sonicated. Sample was pre-cleared with protein G beads at 4°C for 2 h and immunoprecipitated with anti-Flag antibody (M20008-M, Abmart), anti-H3K4me1 antibody (ab176877, Abcam), anti-H3K27ac antibody (ab177178, Abcam), anti-H3K14ac antibody (ab52946, Abcam), anti-Brg1 antibody (#49360, Cell Signalling Technology), anti-Brd9 antibody (#71232, Cell Signalling Technology) at 4°C overnight. Immunoprecipitated chromatins were subsequently eluted and decrosslinked. The immunoprecipitated DNA was purified with phenol:chloroform and analysed by qPCR.
Zhang W., Chen F., Chen R., Xie D., Yang J., Zhao X., Guo R., Zhang Y., Shen Y., Göke J., Liu L, & Lu X. (2019). Zscan4c activates endogenous retrovirus MERVL and cleavage embryo genes. Nucleic Acids Research, 47(16), 8485-8501.
+ Open protocol
+ Expand
7

Histone Post-Translational Modifications Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were washed with PBS and lysed with RIPA lysis buffer for 30 min. Protein concentrations were determined using a BCA Protein Assay Reagent kit (Thermo Scientific). Proteins were separated on 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, blotted onto nitrocellulose membranes, and probed with anti-histone H3K4ac (1:1,000 Abcam, ab232931); anti-histone H3K9ac (1:5,000 Abcam, ab4441); anti-histone H3K27ac (1:200 Abcam, ab177178), anti-histone H3K23ac (1:500 Abcam, ab61234), anti-histone H3 (1:1,000 SANTA, sc-56616); and anti-GAPDH (1:2,000 Abcam, ab125247), followed by the appropriate horseradish peroxidase-conjugated secondary antibodies (Auragene, Changsha, China). Subsequently, immunodetection was performed using an ECL plus WB detection system (Auragene, Changsha, China). IPP 6.0 software was used to determine the signal strength. In the WB experiment, anti-β-actin antibody (1:500) was selected for immunoblotting as an internal control.
Jin Q., Hu H., Yan S., Jin L., Pan Y., Li X., Peng Y, & Cao P. (2021). lncRNA MIR22HG-Derived miR-22-5p Enhances the Radiosensitivity of Hepatocellular Carcinoma by Increasing Histone Acetylation Through the Inhibition of HDAC2 Activity. Frontiers in Oncology, 11, 572585.
+ Open protocol
+ Expand
8

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, total cellular proteins were extracted with RIPA buffer (Beyotime Biotechnology, Shanghai, China) with protease inhibitor to obtain protein according to the manufacturer’s instruction. Then an equal amount of protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% gel and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 5% nonfat milk in Tris-buffered saline/Tween 0.05% (TBST) for 2 h and incubated overnight at 4 °C with primary antibodies of anti-H3K27ac antibody (1:1000, ab177178, Abcam Inc., Shanghai, China), anti-β-actin antibody (1:1000, ab8226, Abcam Inc., Shanghai, China), anti-MMP14 antibody (1:1000, ab51074, Abcam Inc., Shanghai, China), and anti-H3 antibody (1:1000, #4499, Cell Signaling Technology Inc., Shanghai, China). After being washed with TBST, the membrane was incubated with secondary antibodies (1:5000, Signalway Antibody, College Park, MD, USA). Proteins in the membrane were detected using an ECL kit (Millipore, St. Louis, MO, United States), and band images were analyzed using the Bio-Rad ChemiDoc XRS system.
Zhou Y., Liu H., Zheng W., Chen Q., Hu S., Pan Y., Bai Y., Zhang J, & Shao C. (2021). MMP14 Contributes to HDAC Inhibition-Induced Radiosensitization of Glioblastoma. International Journal of Molecular Sciences, 22(19), 10403.
+ Open protocol
+ Expand
9

Mapping Chromatin Signatures and Enhancers

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed as described previously [7 (link)]. 1 × 107 cells were cross-linked with 1% paraformaldehyde for 10 min and suspended in 0.125 M glycine solution for 5 min at room. Then, cell lysates were sonicated, and soluble chromatin was incubated with anti-hnRNPK (ab39975, Abcam) or anti-H3K27ac (ab177178, Abcam) antibody to precipitate immunocomplexes and obtain DNA. ChIP DNA was sequenced on Illumina HiSeq2000 or identified by qPCR. ROSE (Rank Ordering of SE) was utilized to defined SEs and TEs based on the density of H3K27ac signal [5 (link), 22 (link)]. In detail, ROSE was run without promoter exclusion, closely spaced MACS peaks (except those within 2 kb of TSS) within 12.5 kb were merged, followed by the measurement of input and H3K27ac signals; these merged peaks were ranked by H3K27ac signal, then, an inflection point was obtained to establish the cutoff for distinguishing SEs and TEs. Both SEs and TEs were assigned to the Ensemble genes.
Tan Y., Jiang C., Jia Q., Wang J., Huang G, & Tang F. (2022). A novel oncogenic seRNA promotes nasopharyngeal carcinoma metastasis. Cell Death & Disease, 13(4), 401.
+ Open protocol
+ Expand
10

ChIP Assays of LINC00862 Enhancers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP assays were conducted as reported previously [26 ]. The antibodies were used in these assays: Histone H3 (acetyl K27) (Abcam, ab177178), P300 (ab275378, Abcam), BRD4 (A301-985A100, Bethyl Laboratories). The primer sequences are listed below:
LINC00862-enhancer1-F: ATGGCTCTGCCCCTGAAAAA, LINC00862-enhancer1-R: CAGATCCCCATGGAACCACC; LINC00862-enhancer2-F: ACCCACCGGCAATACTTACG, LINC00862-enhancer2-R: GTGGAGAGGACGGCGTTATT; LINC00862-enhancer3-F: TTGCAAAGGAGGCAGTGTGA, LINC00862-enhancer3-R: GCATTGTGGCACTTTGAGCA.
Liu S., Wang Z., Hu L., Ye C., Zhang X., Zhu Z., Li J, & Shen Q. (2024). Pan-cancer analysis of super-enhancer-induced LINC00862 and validation as a SIRT1-promoting factor in cervical cancer and gastric cancer. Translational Oncology, 45, 101982.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!