T7 express competent e coli cells

Manufactured by New England Biolabs

T7 express competent E. coli cells are a strain of E. coli bacteria that have been genetically modified to efficiently express proteins under the control of the T7 promoter. They are designed for high-level protein expression in E. coli.

Automatically generated - may contain errors

Lab products found in correlation

Spin miniprep kit, by Qiagen (1 mentions) In fusion cloning kit, by Takara Bio (1 mentions) Neb 10 beta competent e coli cells, by New England Biolabs (1 mentions) Protease inhibitor, by Thermo Fisher Scientific (1 mentions) Pet duet 1, by New England Biolabs (1 mentions) 10 beta competent e coli cells, by New England Biolabs (1 mentions) Taq polymerase, by Takara Bio (1 mentions) Pacycduet 1, by Merck Group (1 mentions) Pacycduet 1, by New England Biolabs (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Petduet 1, by Merck Group (1 mentions)

Close spelling variants of this product

T7 Express Iq Competent E. coli cells E. coli SHuffle T7 Express competent cells T7 Express lysY/Iq competent E. coli cells T7 Express Competent E. coli T7 Express E. coli cells T7 Express competent cells T7 Express E. coli T7 Express cells T7 Express

5 protocols using t7 express competent e coli cells

Cloning and Screening of MAO-N Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synthesised genes were ligated into a linearised pET16b expression vector (Novagen) using the In-Fusion cloning kit (Clontech), following the manufacturers' protocol. Plasmids were then transformed into T7 express competent E. coli cells (New England Biolabs) and spread onto LB agar plates (100 μg ml⁻¹ ampicillin) and incubated overnight at 37°C. For direct functional screening, cells were spread onto a Hybond-N transfer membrane, which enabled the E. coli transformants to be transferred to an agar plate containing 1 mM isopropyl-beta-d-thiogalactopyranoside to induce protein expression. For MAO-N activity assays, the induced bacterial colonies were analysed for oxidase activity through the production of hydrogen peroxide by the colorimetric assay outlined by Alexeeva et al. (2002 (link), 2003 (link)) using α-methylbenzylamine as the substrate.
To determine the DNA sequence of the synthesised constructs, bacterial colonies were inoculated and grown in liquid culture (LB with 100 μg ml⁻¹ ampicillin), followed by plasmid extraction (Spin Miniprep kit, Qiagen) and Sanger sequencing (DNA Sequencing Facility, University of Manchester).

Currin A., Swainston N., Day P.J, & Kell D.B. (2014). SpeedyGenes: an improved gene synthesis method for the efficient production of error-corrected, synthetic protein libraries for directed evolution. Protein Engineering, Design and Selection, 27(9), 273-280.

+ Open protocol

+ Expand

Cultivation of Rhodobacter capsulatus Strains

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three Rhodobacter capsulatus strains were used in this study: rifampicin sensitive wild-type strain B10 (Wall et al., 1975 (link)), a rifampicin resistant derivative SB1003 (ATCC BAA-309) and an RcGTA overproducer strain DE442 (Ding et al., 2014 ; Fogg et al., 2012 (link)). All R. capsulatus cultures were grown at 30°C either aerated in the dark or in anoxic sealed tubes under constant illumination. Two growth media were used – YPS complex broth (0.3% w/v yeast extract, 0.3% w/v peptone, 2 mM MgCl₂, 2 mM CaCl₂) or RCV defined broth (10 mM potassium phosphate buffer, 0.4% w/v L-malic acid, 0.1% w/v (NH₄)₂SO₄, 0.020% w/v MgSO₄^.7H₂O, 0.0075% w/v CaCl₂^.2H₂O, 0.0012% w/v FeSO₄^.7H₂O, 0.0020% w/v Na₂EDTA, 0.0001% w/v thiamine hydrochloride. Plus 1 mL of trace element solution - 0.07% w/v H₃BO₃, 0.040% w/v MnSO₄^.H₂O, 0.019% w/v Na₂MoO₄^.2H₂O, 0.006% w/v ZnSO₄^.7H₂O, 0.001% w/v Cu(NO₃)^.3H₂O. The pH was adjusted to 6.8 with NaOH). For agar plates, 1.5% w/v agar was added to the above broth recipes. The E. coli S17-1 strain (DSM 9079), which contains chromosomally integrated tra genes, was used as a donor for all conjugations. NEB 10-beta Competent E. coli cells (New England Biolabs) were used for standard cloning and plasmid maintenance; T7 Express Competent E. coli cells (New England Biolabs) were used for overexpression of proteins for purification.

Sherlock D, & Fogg P.C. (2022). The archetypal gene transfer agent RcGTA is regulated via direct interaction with the enigmatic RNA polymerase omega subunit. Cell Reports, 40(6), 111183.

+ Open protocol

+ Expand

Cloning and Expressing Glycoside Hydrolases

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 57 glycoside hydrolase enzymes found in the genome sequence of LL1355 were annotated with putative enzymatic activities based on their top hits by BLAST (NCBI-NIH). 27 different enzymes were selected from LL1355 and cloned into E. coli using the pEXP-5-NT/TOPO (Thermo Fisher Scientific) plasmid. The plasmids were then transformed into T7-Express competent E. coli cells (New England Biolabs, Ipswich, MA) to obtain strains which were subsequently used for protein expression. An empty pEXP-5-NT plasmid was also cloned to serve as a negative control.

Beri D., York W.S., Lynd L.R., Peña M.J, & Herring C.D. (2020). Development of a thermophilic coculture for corn fiber conversion to ethanol. Nature Communications, 11, 1937.

+ Open protocol

+ Expand

Expression and Purification of AlkB Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

AlkB enzymes (wild type, D135S and S135T) were expressed in T7 express competent E. coli cells (New England Biolabs Inc.). Cells were grown in a 2 l scale LB medium at 37°C until the OD₆₀₀ reached 0.4–0.8. Isopropyl β-d-1-thiogalactopyranoside (IPTG) and freshly made FeSO₄ solution were added to the culture to 1 mM and 5 μM, respectively, and the culture was grown at 30°C for additional 4 h to induce the AlkB expression. Cells were pelleted and resuspended in lysis buffer containing 10 mM Tris–HCl pH 7.4, 300 mM NaCl, 5% glycerol, 2 mM CaCl₂, 10 mM MgCl₂, 2 mM 2-mercaptoethanol and 1× protease inhibitor (Thermo Fisher Scientific). Cells were then lysed with sonication and centrifuged at 13 000 rpm for 45 min. The supernatant was first purified with a manual Ni-NTA column and eluted with a buffer containing 10 mM Tris–HCl pH 7.4, 300 mM NaCl and 250 mM imidazole. The protein was then further purified using Mono S chromatography. The protein was eluted with gradient buffers composed of different ratios of buffer A (10 mM Tris–HCl pH 7.4 and 100 mM NaCl) and buffer B (10 mM Tris–HCl pH 7.4 and 1.5 M NaCl) and then buffer exchanged to the storage buffer (10 mM Tris–HCl pH 7.4, 250 mM NaCl). Glycerol was then added to 30%. The protein was aliquoted, snap frozen in liquid nitrogen and stored at –80°C.

Wang Y., Katanski C.D., Watkins C., Pan J.N., Dai Q., Jiang Z, & Pan T. (2020). A high-throughput screening method for evolving a demethylase enzyme with improved and new functionalities. Nucleic Acids Research, 49(5), e30.

+ Open protocol

+ Expand

Cloning and Co-expression of HpaII Methyltransferases

Check if the same lab product or an alternative is used in the 5 most similar protocols

Haemophilus influenzae was acquired from the American Type Culture Collection (ATCC® 49699™), and cultured in ATCC® Medium 814: GC Agar/Broth Medium (Teknova) at 37°C overnight with shaking. Total genomic DNA was isolated with the DNeasy Blood and Tissue Kit (Qiagen). The HpaII gene was amplified using forward primer GAGATATACCATGGCTGAATTTTTTTCTGGTAATAGAGG and reverse primer TCGAGGCTGCAGTTATAAGAATCTAATTTGTACGTTTAACTTAATAAAAAAATC (IDT, San Diego, CA) and the M. HpaII gene was amplified using forward primer AGATATACATATGAAAGATGTG TTAGATGATAA CTTGTTAG and reverse primer TCGAGGGTACCTCAGTCATATAAATTTCCTAATTTTTCT AAAATTTTCTTACCT (IDT, San Diego, CA). PCR was performed with Taq polymerase (Clontech) using the following cycle 95°C for 5 minutes, 40 cycles of (94°C for 15 seconds, 55°C for 15 seconds, 72°C for 1 minute), and 72°C for 5 minutes. The ~1100 bp HpaII PCR fragment was cloned using NcoI and PstI restriction sites in frame with the 5’ His tag of pETDuet-1 (EMD Millipore). The ~1100 bp M. HpaII PCR fragment was cloned using NdeI and KpnI into pACYCDuet-1 (EMD Millipore).
Recombinant vectors were isolated in 10-beta Competent E. coli cells (New England Biolabs). Co-transformations with pETDuet-1/HpaII and pACYCDuet-1/M. HpaII were executed in T7 Express Competent E. coli cells (New England Biolabs) by heat shock.

Liu G., Weston C.Q., Pham L.K., Waltz S., Barnes H., King P., Sphar D., Yamamoto R.T, & Forsyth R.A. (2016). Epigenetic Segregation of Microbial Genomes from Complex Samples Using Restriction Endonucleases HpaII and McrB. PLoS ONE, 11(1), e0146064.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!