For fluorescent whole amount in situ hybridization (ISH), we followed the protocol outlined in Andrikou et al. (2013) (link). The fluorescent signal was developed with fluorophore-conjugated TSA cyanine 3 (1:400 reagent diluents, Perkin Elmer, ref#NEL760001KT). Labeled probes were in vitro transcribed from linearized DNA with digoxigenin-11-UTP (Roche, USA). Since little overlap was seen among the nucleotide sequences of SpRb1, SpRb1-like1 and SpRb1-like2, the probe for each gene was designed to cover the majority of the ORF using the following primers: SpRb1 (F-CCACTTACTGCGTGCTTCAA, R-GAGGCTTGAACCCCTACCTC), SpRb1-Like1 (F- GACAAGCTGTGTGAGGTCCA, R- TGCAGGATAGCCTCTTCGAT) and SpRb1-Like2 (F- TCCGAGGAGATCGTGCTGACTAC, R- CGATCGTGATCGCCGTTTTTC). Template of the probe was sequenced prior to probe generation and cloned in the pGEM®-T Easy Vector (Promega, Madison, WI, USA) for subsequent in vitro transcription using either SP6 or T7 MEGAscript Transcription kit (Thermo Fisher Scientific, #AM1330 or AM1333). Hoechst 33342 Solution (ThermoFisher, ref#62249) was used as a counter-staining at a final concentration of 0.1 mg/ml. Samples were imaged with Olympus FV3000 confocal microscope.
Tsa cyanine 3
Manufactured by PerkinElmer
Sourced in United States
TSA cyanine 3 is a fluorescent dye used for signal amplification in immunohistochemistry and in situ hybridization applications. It is a member of the cyanine dye family and is known for its bright fluorescent signal and photostability.
Automatically generated - may contain errors
Lab products found in correlation
Hoechst 33342 solution, by Thermo Fisher Scientific (2 mentions)
Megascript t7 transcription kit, by Thermo Fisher Scientific (2 mentions)
Digoxigenin 11 utp, by Roche (2 mentions)
Pgem t easy vector, by Promega (1 mentions)
Fv3000 confocal microscope, by Olympus (1 mentions)
Alexa fluor 488 goat anti mouse igg, by Vector Laboratories (1 mentions)
A11120, by Thermo Fisher Scientific (1 mentions)
Vectastain abc kit, by Vector Laboratories (1 mentions)
Hoechst dye, by Thermo Fisher Scientific (1 mentions)
Fv3000, by Nikon (1 mentions)
6 protocols using tsa cyanine 3
1
Fluorescent Whole-Mount In Situ Hybridization
2
Fluorescent Probe Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DIG- and fluorescein isothiocyanate (FITC)-labeled probes were synthesized and detected by using anti-DIG (1:500 dilution) and anti-FITC (1:500 dilution) specific antibodies coupled to horse radish peroxidase. The signal was developed with tyramide signal amplification (TSA) cyanine 3 or TSA fluorescein system kits, respectively (both Perkin Elmer, United States), following the manufacturer’s protocol.
3
Dual Antibody Staining with TSA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Staining was performed as described previously when using two antibodies raised in two different species (6) . When using two different epitope-specific antibodies raised in the same species, a fluorescent Cy3-coupled TSA substrate (TSA Cyanine 3, Perkin Elmer, Waltham, MA, USA) was used to detect secondary horseradish peroxidase-conjugated antibodies bound to the first primary antibody. Sections were next boiled again in TEG buffer to remove bound antibodies, but the TSA substrate remained attached, followed by a new round of immunolabeling, using the second primary antibody and subsequent Alexa-labeled 488 secondary antibodies.
4
Corticospinal Tract Regeneration Imaging
5
Zif-268 and GFP Immunostaining in Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After anesthetization with diethyl ether, mice were transcardially perfused with PBS followed by 4% paraformaldehyde (PFA). Brains were post-fixed in 4% PFA for 2–4 h. Free-floating coronal sections (40 μm) were prepared using a cryostat. The sections were incubated with 0.2% Triton-X-100 and 5% goat serum for 1 h, primary antibodies including polyclonal anti-Zif-268 antibody (SC-189, 1:5000; Santa Cruz) and anti-green fluorescent protein (GFP) primary antibody (A11120, 1:1000, Invitrogen) at 4 °C overnight, followed by incubation with secondary antibodies including goat anti-rabbit biotinylated antibody (A31553, 1:400; Life Technologies) and Alexa Fluor 488 goat anti-mouse IgG for 2 h, VECTASTAIN ABC Kit (Vector Laboratories) for 1.5 h, and TSA-Cyanine 3 (SAT704A001EA, 1:1000; Perkin–Elmer) for 1 h. The sections were mounted in PermaFluor (ThermoShandon, Pittsburgh, PA, United States). Nuclei were counterstained with Hoechst dye (1:1000; Invitrogen).
6
Fluorescent Whole Mount In Situ Hybridization Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!