Total DNA was extracted from approximately 1 mm2 sections of mouse spleen or liver using the DNAzol reagent (Life Technologies). HCMV genomes were analyzed using quantitative PCR (TaqMan) performed on 1 ug of total DNA and using TaqMan FastAdvance PCR Master Mix (Applied Biosystems), according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe: CGAGGGAGAGCAAGTT; forward primer: 5′GATGTGGGCCGAGAATTATGA and reverse primer: 5′ATGGGCCAGGAGTGTGTCA). The probe contains a 5′ FAM reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was activated at 95 °C for 10 minutes followed by 40 cycles (15 s at 95 °C and 1 min at 60 °C) using a StepOnePlus TaqMan PCR machine. Results were analyzed using ABI StepOne software (Applied Biosystems).
5 fam reporter molecule
Manufactured by Thermo Fisher Scientific
The 5' FAM reporter molecule is a fluorescent dye commonly used in molecular biology applications. It is attached to the 5' end of DNA or RNA molecules to enable their detection and quantification. The 5' FAM reporter emits green fluorescence when excited, allowing for sensitive and real-time monitoring of target sequences during various analytical procedures such as PCR and DNA sequencing.
Automatically generated - may contain errors
2 protocols using 5 fam reporter molecule
1
Quantification of HCMV Genomes in Mouse Tissues
2
Quantification of HCMV Genomes in Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from approximately 1 mm2 sections of mouse spleen or liver using the DNAzol reagent (Life Technologies). Quantitative PCR (TaqMan) was performed on 1 µg of total DNA using TaqMan FastAdvance PCR Master Mix (Applied Biosystems), according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe: 5′CGAGGGAGAGCAAGTT; forward primer: 5′GATGTGGGCCGAGAATTATGA and reverse primer: 5′ATGGGCCAGGAGTGTGTCA). The probe contains a 5′ FAM reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was activated at 95 °C for 10 minutes followed by 40 cycles (15 s at 95 °C and 1 minute at 60 °C) using a StepOnePlus TaqMan PCR machine. Results were analyzed using ABI StepOne software (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!