Zymoclean kit

First, a multicopy plasmid for yeast containing the aroE gene (encoding shikimate dehydrogenase (SDH)) under expression of the strong promoter TDH3 was constructed. The aroE gene was amplified from E. coli DH5α (18258-012, Invitrogen) genomic DNA with PCR using primer pairs SDH forward pTDH3 overlap (5′ AGTTTCGACGGATTCTAGAACTAGTATGGAAACCTATGCTGTTTTTGGTAATC 3′), SDH reverse tCYC1 overlap (5′ TAACTAATTACATGACTCGAGTCACGCGGACAATTCCTCCTG 3′) (Sigma-Aldrich) and Phusion^® Hot Start II High Fidelity Polymerase (Thermo Scientific, Waltham, MA). The PCR product was purified from 1% agarose (w/v) gel using the Zymoclean™ kit (Zymo Research, Irvine, CA). The plasmid pAG426GPD-ccdB (Addgene, Cambridge, MA, USA) was restricted with SpeI and XhoI (Thermo Scientific), following gel purification of its backbone. The aroE cassette was assembled into this backbone using In-Fusion cloning (Clontech, Mountain View, CA, USA). The resulting plasmid pAG426-GPD-SDH was transformed into E. coli and confirmed using restriction analysis with SnaBI, SpeI and XhoI (Thermo Scientific). The plasmid was then transformed to S. cerevisiae strain CEN.PK113-5D using the lithium acetate protocol46 (link), yielding strain CEN.PK-aroE.

Viral RNA samples from purified virions served as a template for cDNA synthesis using random hexamer and oligo dT₁₇VN primers with a Maxima reverse transcriptase (Fermentas). The cDNA served as a template for the second strand synthesis using the Universal RiboClone cDNA Synthesis System (Promega, Madison, WI, USA), according to the manufacturer’s instructions. The ds-cDNA was purified using the Zymoclean kit (Zymo Research, Irvine, CA, USA), and the obtained double-stranded fragments were cloned as a library into a commercial pUC19/SmaI (Fermentas). The library was then transformed into DH5α competent cells, and insert-positive colonies were cultured in LB media, including antibiotics. The plasmids were extracted using a plasmid extraction kit (Bioneer, Daejeon, Republic of Korea) and sequenced by Sanger sequencing (HyLabs, Rehovot, Israel).
Based on the obtained sequences, the primer pairs were designed (Table 1) and used for RT-PCR to obtain the unidentified genome segments. The 5′ end of the genome was identified using the RACE strategy on cDNA derived from viral RNA extractions, while the 3’ end was sequenced using the oligo dT₁₇VN primer.

The sequence of the MGAT1 CHO gene was confirmed using primers based on the predicted mRNA transcript (XM_007644560.1 [83 (link)]). Genomic DNA was extracted using the AllPrep kit (Qiagen, Germantown, MD, US). The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US). The PCR product was gel purified using a Zymoclean kit (Zymo Research, Irvine, CA, US) and then sequenced by Sanger method at UC Berkeley, Berkeley, CA, US. MGAT1 knockouts were sequenced in the same manner.