Taq polymerase

Genomic DNA was isolated from PBMC using QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer´s protocol. Concentration and quality of DNA samples were determined by UV absorption (260/280 nm), and DNA was stored at 4°C until usage. Exon 5 of human KLRB1 was amplified by PCR using primers 161-Ex5-sense (5´-GAT ACA CAC ACA GAA CCT GAT ACG TG-3´) and 161-R2-antisense (5´-CAA ATA AGT TAG TCT ATT TCC TGT C-3´) and 100–250 ng of genomic DNA. Final concentrations were 0.3 μM of each primer, 200 μM dNTPs, 1.5 mM MgCl₂ in Taq polymerase reaction buffer, and 2U of Taq polymerase (Qiagen) in a total volume of 30 μl. Samples were amplified using 36 cycles in a Perkin Elmer GeneAmp PCR System 9600 (McKinley Scientific, Sparta, NJ, USA). PCR reaction products (3 μl) were controlled by horizontal ethidium bromide-stained 1% agarose gel-electrophoresis. For sequencing, amplification products were purified from PCR reactions by Nucleospin Extract II (Macherey & Nagel, Düren, Germany) according to the manufacturer´s recommendations. Automated sequencing was performed subsequently using sequencing primer (5´-ACA CAG AAC CTG ATA CGT G-3´). Separation and visualization of sequencing products was performed with an ABI PRISM 377 Genetic Analyzer (Life Technologies, Applied Biosystems, Darmstadt, Germany).

Total RNA was extracted from neurospheres (Qiagen) and reverse-transcribed (Superscript II, Promega) with random hexamers. Semi-quantitative PCR was performed with 100 ng of cDNA with Taq polymerase (Qiagen) for 30 cycles before gel electrophoresis in the presence of Sybr DNA dye. Quantitative PCR were performed using a Sybr PCR kit (Qiagen) and a LightCycler 480 apparatus (Roche). Primers sequences: OCAM-GPI (CCAAGCAGTGGCAAGAGTTT & GCATTCAGATGCCATGACTG); OCAM-TM (ATGGGCTACGAAGTGCAAAT & TGGACTCCCATCTTCATGGT); OCAM for QPCR (GGTGTCCCCTCAAGAGTTCA & GGATGGTGGTGACTTCCTCA); KI67 (GACTAGAAACCAAGCTGCGG & GCTGAGTTAAAGAGAGCCGC); ErbB2 (GAGCCTTCGGCACTGTCTAC & ACGTGGTTGGGACTCTTGAC); β-actin (AGACTTCGAGCAGGAGATGG & GTGCTAGGAGCCAGAGCAGT); GAPDH (TGTCCGTCGTGGATCTGAC & CCTGCTTCACCACCTTCTTG).

The different regions of the htrA gene were amplified using the primers A–F. The PCR reaction mixture (50 μl) contained 50 ng of genomic DNA, 1 U Taq polymerase (Qiagen, Hilden), 200 μM of each dNTP, 0.2 μM of each primer and 1× Taq polymerase buffer (supplied by the manufacturer). The following conditions were used for amplification: for primer pairs A–F/C–F, an initial denaturation for 5 min at 94°C, followed by 30 cycles of 1 min at 94°C, 30 s at 60°C and 2 min at 72° was performed. A final extension was done for 10 min at 72°C. For the primer sets A–D/C–D/E–F the elongation time was reduced to 1 min at 72°C and for the primers A–B the annealing step was adjusted to 30 s at 58°C and the elongation time to 30 s at 72°C. PCR products were separated on a 1.5% (w/v) agarose gel.

Snap-frozen sperm and somatic tissue samples were subjected to genomic DNA isolation using a DNeasy Tissue kit (Qiagen, Valencia, CA), and DNA samples were normalized to 20 ng/μl. As an initial step for the I-PCR analyses (Figure 1()), genomic DNA (300 ng) was digested with NcoI (New England Biolabs, Ipswich, MA) at 37°C for 4 hours followed by self-ligation of the digests using T4 ligase (Promega, Madison, WI) overnight at 4°C. The MLV-ERV landscape information was collected by I-PCR amplification of the junctions spanning putative MLV-ERV integration loci using 2 μl of the ligation products, Taq polymerase (Qiagen), and a pair of inverse primers (ISL-F1 and ISL-R1) designed from the conserved MLV-ERV sequences. The primer sequences and PCR conditions are listed in Supplementary Table 1 available online at https://doi.org/10.1155/2017/3152410. I-PCR products were resolved on a 7.5% polyacrylamide gel followed by ethidium bromide staining for visualization.

PCR was performed using Taq polymerase (Qiagen, Valencia, CA) according to the manufacturer’s instructions, with custom-designed primers. The PCR products were bidirectionally sequenced using an automated sequencer (3730; Applied Biosystems, Foster City, CA). Mutation positions are reported in reference to NM_021978.