Reverse transcription kit

Total RNA were extracted from VSMCs using the total RNA extraction kit (Ambion, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. Extracted RNA was quantified using Nanodrop™ 1000 Spectrophotometer (Thermo Fisher Scientific) and reverse transcribed using a Roche Reverse Transcription Kit (Hoffman-La Roche Ltd., Basel, Switzerland) (100 ng RNA per reaction). A genomic DNA removal step was included, and the resulting cDNA was diluted in 10 mM Tris-HCl, pH 8. Real-time quantitative PCR was performed in Illumina Eco Real-Time PCR with Roche SYBR Green Master Mix and primers for MMP-2, MMP-9, MMP-13, IκB, and 36B4, which is a housekeeping gene. Primers are listed in Table 1. To confirm amplification specificity, PCR products from each primer pair were subjected to agarose gel electrophoresis. Relative mRNA expression levels were calculated by using the Delta-Delta Ct method using 36B4 as a normalization control.

The reverse transcription of RNA was
performed in two steps according to the instructions of Roche Reverse
Transcription Kit.^{29 (link)} The RNA concentration
and purity were determined by a Nano Drop spectrophotometer (Nano
Drop Technologies, Wilmington, DE), and the determination was performed
by ABI fluorescence quantitative PCR (Rrism 7500, Applied Biosystems,
Foster City, CA). The cDNA was obtained and stored in a refrigerator
at −20 °C for standby. The RT-PCR amplification reaction
was performed according to the instructions of FastStart DNA Master
SYBR Green I kit. Twenty microliters of the reaction system (10 μL
of SYBR Green Master + 6 μL of DNase/RNase-Free Water + 2 μL
of cDNA + 2 μL primer) was used to detect the effect of samples
on the expression of genes related to the ox-LDL-induced foam of macrophages.
Gene-specific primers were as below: GAPDH (forward, 5′-TTTGTCAAGCTCATTTCCTGGTATG-3′,
reverse, 5′-TGGGATAGGGCCTCTCTTGC-3′), ABCA1 (forward,
5′-CCCAGAGCAAAAAGGGACTC-3′, reverse, 5′-GGTCATCATCACTTTGGTCCTTG-3′),
ABCG1 (forward, 5′-CAAGACCCTTTTGAAAGGGATCTC-3′, reverse,
5′-GCCAGAATATTCATGAGTGTGGAC-3′), SRA1 (forward, 5′-TTAAAGGTGATCGGGGACAAA-3′,
reverse, 5′-CAACCAGTCGAACTGTCTTAAG-3′), SRB1 (forward,
5′-GCAAATTTGGCCTGTTTGTT-3′, reverse, 5′-GATCTTGCTGAGTCCGTTCC-3′),
and CD36 (forward, 5′-CAAGCTCCTTGGCATGGTAGA-3′, reverse,
5′-TGGATTTGCAAGCACAATATGAA-3′).

According to the manufacturer's instructions, total RNA was collected from the cultivated cell lines using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Ultraviolet spectroscopy was employed to calculate the concentration of RNA using the NanoDrop 2000. The Roche Reverse Transcription Kit was then used to reverse transcribe the RNA into cDNA. The endogenous control used for studying gene expression was glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The fold change of gene expression was calculated using the 2^-△△Ct method. The primer sequences were as follows: METTL3 Forward: 5′- GTCCATCTGTCTTGCCATCTC -3′, Reverse: 5′- GAGACCTCGCTTTACCTCAATC -3’; FOXO3a Forward: 5′- AGCCTAACCAGGGAAGTTTG -3′, Reverse: 5′- GACTCACTCAAGCCCATGTT -3′, DNMT1 forward: 5′ CCAAAGAACCAACACCCAAAC-3′, Reverse: 5′ CTCATCTTTCTCGTCTCCATCTTC-3’.