Neon r buffer

To generate CENP-F mutant cells, CRISPR/Cas9 was used to target the Miro-binding domain of CENP-F (guide RNA target sequence GGGATGTCAGCAAACCCTAAGGG). To prepare the guide RNA, a double-strand DNA template was PCR-assembled using two partially overlapping oligonucleotides (15 and 16, Table 2). The resulting DNA contains a minimal T7 promoter sequence, an invariant Cas9-scaffold sequence, and the CENP-F target sequence. DNA was transcribed in vitro using a MEGAshortscript T7 Transcription Kit and cleaned using a MEGAclear Transcription Clean-Up Kit. Cas9 RNPs were assembled by incubating 120 pmol of Cas9 protein (a kind gift from Martin Jinek, University of Zurich) with 100 pmol of guide RNA in 15 μl of Neon R buffer (Neon electroporation system, Invitrogen) at room temperature for 15 min. We harvested 200,000 cells and resuspended them in 5 μl of Neon R buffer. Cas9 ribonuclear proteins were added to the cells, and the mixture was electroporated using 10-μl Neon tips. Electroporation parameters were set to 1400 V, 15 ms and four pulses. Three days after electroporation, cells were single-cloned and further expanded. The targeted CENP-F locus was sequenced to check for mutation.