For lentivirus production, HEK293T cells were transfected with the self-inactivating lentiviral vector construct, the packaging construct and the VSV-G- and Rev-expressing construct. After 48 h of incubation, culture supernatants were collected and centrifuged at 50,000 x g for 1 h at 20°C to concentrate lentivirus. MT-2 or MT-4 cells were infected with the lentivirus at 400 x g for 2 h at 20°C. After 48 h, puromycin (Wako) was added to the medium, and puromycin-resistant cell pools were used for further experiments. The following target sequences were used: Tax-1, 5′-GGCCTTCCTCACCAATGTTCC-3′; Tax-2, 5′-GGCAGATGACAATGACCATGA-3′; Tax-3, 5′-GCCTACATCGTCACGCCCTAC-3′; HOIP-1, 5′-GCTGCAGCTTTCAGAATTTGA-3′; HOIP-2, 5′-GCACTGCCCATCCTGTAAACA-3′; HOIP-3, 5′-GCTCCTTTGGCTTCATATATG-3′; Control, 5′-GATTTCGAGTCGTCTTAATGT-3′.
Puromycin
Manufactured by Fujifilm
Sourced in Japan, United States
Puromycin is a laboratory reagent used in cell culture applications. It functions as a selective antibiotic, inhibiting protein synthesis in eukaryotic cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Hygromycin b, by Fujifilm (4 mentions)
Blasticidin s, by Fujifilm (4 mentions)
Dulbecco modified eagle medium (dmem), by Fujifilm (4 mentions)
Fugene hd, by Promega (4 mentions)
Pei max reagent, by Polysciences (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Sc 37657 5, by Santa Cruz Biotechnology (2 mentions)
Dulbecco modified eagle medium (dmem), by Nacalai Tesque (2 mentions)
Hygromycin, by Fujifilm (2 mentions)
Polybrene, by Merck Group (2 mentions)
Fetal bovine serum (fbs), by Biowest (2 mentions)
Mouse monoclonal antipuromycin antibody, by Merck Group (2 mentions)
Y 27632, by Fujifilm (2 mentions)
Imatrix 511, by Takara Bio (2 mentions)
Penicillin streptomycin, by Fujifilm (2 mentions)
Puromycin, by InvivoGen (2 mentions)
Prsi12 u6 sh hts4 ubic tagrfp 2a puro plasmid, by Cellecta (2 mentions)
Pcmv vsv g rsv rev, by RIKEN BioResource Center (2 mentions)
Pcag hivgp, by RIKEN BioResource Center (2 mentions)
57 protocols using puromycin
1
Lentiviral Transduction and Knockdown Assay
2
In Vivo Muscle Protein Synthesis Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Muscle Protein Synthesis was measured using the in vivo SUnSET method (Schmidt et al., 2009 (link); Goodman et al., 2011b (link)). Under isoflurane anesthesia, 0.04 μmol puromycin/g body weight (Wako, Tokyo, Japan) diluted in a 0.02 M phosphate-buffered saline (PBS) stock solution was injected intraperitoneally, and the gastrocnemius muscle was removed exactly 15 min after puromycin administration. After the homogenization and centrifugation at 2,000 g for 3 min at 4°C, the supernatant was collected and processed for western blotting. puromycin labeling of the nascent polypeptide was detected using the mouse monoclonal anti-puromycin antibody (cat#MABE343, Merck Millipore, Billerica, MA, United States), which evaluated all protein ladder bands on the membrane.
3
Retroviral Transduction of Mouse Cx3cl1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LLC and SCT cells were infected with retrovirus encoding mouse Cx3cl1 (in pMarX-puro) and mouse Cx3cl1 shRNA (in pRetrosuper-puro) or SV40LT antigen (in pMarX-puro), respectively. Infected cells were selected in 5 µg/ml puromycin-containing medium for 7 days, and the selected cells were maintained in medium containing 1 µg/ml puromycin (Wako Pure Chemical Industries).
4
In Vitro Translation Assay with PUREfrex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro transcription and translation were performed with PUREfrex 1.0 (GeneFrontier) at 37°C for 30 min following the manufacturer's instructions. The DNA fragment was amplified from pCA24N plasmids (see above and Supplemental Table 5 ) with primer 1 (5′-GGCCTAATACGACTCACTATAGGAGAAATCATAAAAAATTTATTTGCTTTGTGAGCGG-3′) and primer 3 (5′-AGTCAGTCACGATGAATTCCCCTAGCTTGG-3′) (Chadani et al. 2016 (link)) and used for the assay. Translated products were run on a Bolt 12% Bis-Tris Plus gel (Thermo Fisher Scientific) with Bolt MES SDS Running Buffer (Thermo Fisher Scientific). For western blotting, 35S-methionine was removed from the reaction. For puromycin treatment, the in vitro translation reaction was further incubated with 1 mg/mL puromycin (FUJIFILM Wako Chemicals) at 37°C for 5 min.
5
In Vivo Measurement of Muscle Protein Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Muscle protein synthesis was measured by the in vivo SUnSET method57 (link). Under the anaesthesia, 0.04 μmol puromycin/g body wt (Wako, Tokyo, Japan) diluted in a 0.02 M PBS stock solution was injected intraperitoneally, and the gastrocnemius muscle was removed exactly 15 min after puromycin administration. Following homogenization as described above and centrifugation at 2,000 g for 3 min at 4 °C, the supernatant was collected and processed for western blotting. A mouse monoclonal anti-puromycin antibody (cat#MABE343, Millipore, Billerica, MA) was used to detect puromycin incorporation, which was evaluated as the sum of intensity of all protein bands in the western blot.
6
Stable ADAR1 Knockdown in RPTECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPTECs were infected with lentiviral particles expressing small hairpin RNA (shRNA) against the human ADAR1 gene (sc-37657-V; Santa Cruz Biotechnology), which contained three target-specific constructs encoding 19 to 25-nucleotide shRNA designed to repress the expression of ADAR1. To select clones stably expressing shRNA, cells were maintained in a medium containing 5 μg/ml of puromycin (FUJIFILM Wako Pure Chemical Corporation). Downregulation of ADAR1 was confirmed by Western blotting. To construct mock-transduced RPTECs as control cells, naive RPTECs were infected with lentivirus particles derived from pLVSIN-CMV Pur vector (Takara Bio Inc) and were cultured in puromycin-containing medium as described above to select the stably expressing cells.
7
Generating Recombinant KSHV Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For maintenance, iSLK cells were cultured in growth medium of DMEM/fetal calf serum 10% containing 1 μg/mL puromycin (Fujifilm-Wako Chemicals, Osaka, Japan) and 0.25 mg/mL of G418 (Fujifilm-Wako Chemicals). KSHV BAC16 mutant (∆ORF34-BAC16) and its revertant (∆ORF34Rev-BAC16), as previously described (20 (link)), were transfected to iSLK cells using Screenfect A plus (Fujifilm-Wako Chemicals) according to the manufacturer’s instructions. Transfected cells were selected under 1000 μg/mL of hygromycin B (Fujifilm-Wako Chemicals) to establish doxycycline-inducible recombinant KSHV-producing cell lines (iSLK-∆34Rev and iSLK-∆34).
To establish stable ORF34-expressing cells for complementation, pCI-blast-3xFLAG-ORF34 and empty vector pCI-blast-3xFLAG were transfected into iSLK-∆34Rev and iSLK-∆34 cells, and transfected cells were selected and maintained in 10 μg/mL and 7.5 μg/mL of Blasticidin S (Fujifilm-Wako Chemicals), respectively. Thus, the stable cell lines iSLK-∆34Rev/pCI-blast-3xFLAG, iSLK-∆34/pCI-blast-3xFLAG, iSLK-∆34/pCI-blast-3xFLAG-ORF34WT, and iSLK-∆34/pCI-blast-3xFLAG-ORF34 mutants were established.
To establish stable ORF34-expressing cells for complementation, pCI-blast-3xFLAG-ORF34 and empty vector pCI-blast-3xFLAG were transfected into iSLK-∆34Rev and iSLK-∆34 cells, and transfected cells were selected and maintained in 10 μg/mL and 7.5 μg/mL of Blasticidin S (Fujifilm-Wako Chemicals), respectively. Thus, the stable cell lines iSLK-∆34Rev/pCI-blast-3xFLAG, iSLK-∆34/pCI-blast-3xFLAG, iSLK-∆34/pCI-blast-3xFLAG-ORF34WT, and iSLK-∆34/pCI-blast-3xFLAG-ORF34 mutants were established.
8
Generating CNX-knockdown cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We purchased OriGene pRS shRNA vectors containing short hairpin RNA for CNX (CNX-shRNA, #TR314210) and non-specific shRNA (#TR20003), and the puromycin-resistant marker from OriGene Technologies (Rockville, MD, USA). We transfected the BeWo cells with the vectors by using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), and we acquired stably gene-transfected cells, in which the shRNA is integrated, by using puromycin (Wako Pure Chemicals, 1.0 µg/mL) for selection. We isolated two CNX-knockdown clones (CNX-shRNA-1 and CNX-shRNA-2), in which expression of CNX protein was suppressed, from the transfectants.
9
DTX3L Gene Silencing and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silencing vector pRNAT-U6–1-Neo (Invitrogen) was used for construction of the DTX3L silencing vector. A double-strand DNA fragment including a knockdown sequence for mouse Dtx3l was inserted into BamHI and HindIII sites. Control and DTX3L silencing vectors were transfected into B16F10 cells, and stable cell clones were selected with 1 mg/ml neomycin (Wako). Oligonucleotide sequences of the DNA fragment are 5′-GATC CGCATGGAGGGTAG TGATGGAATTAATTCA AGAGATTAATTCCATCACTACCCTCCATGCTTTTT TA-3′ and 5′- AGCTTAAAAAAGCATGGAGGGTAGTG ATGGAATTAATCTCTTGAATTAATTCCATCACTAC CCTCCATGCG-3′. Expression vector pCMV-c-Fa-Puro3 (Invitrogen) was used for construction of the DTX3L expression vector. The human DTX3L coding region fused with a FLAG sequence was inserted into BamHI and XhoI sites. Empty and DTX3L expression vectors were transfected into G361 cells, and stable cell clones were selected with 1 mg/ml puromycin (Wako).
10
Cell Culture Protocol for MCF-7 and Plat-A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF-7 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in Eagle’s Minimal Essential Medium (Wako, Osaka, Japan) with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA, USA), 1% penicillin streptomycin (P/S) (Sigma-Aldrich, St. Louis, MO, USA), 10 μg/mL insulin (Wako), 1% MEM Non-essential Amino Acids Solution (Wako) and 1 mM Sodium Pyruvate Solution. Plat-A cells were kindly provided by Toshio Kitamura and cultured in DMEM (high glucose) with 10% FBS, 1% P/S, 1 μg/mL puromycin (Wako) and 10 μg/mL blasticidin (Funakoshi, Tokyo, Japan). Nutlin-3a was supplied by Cayman (Ann Arbor, MI, USA). The chemical structure of Nutlin-3a has been shown in previous studies [25 (link), 52 (link)]. RITA was purchased from Adooq Bioscience (Irvine, CA, USA). Olaparib was purchased from ChemScene, LLC (Monmouth Junction, NJ, USA). MG132, PJ34 and cisplatin were purchased from Wako. cisplatin was dissolved in 90% dimethyl sulfoxide in phosphate buffered saline (90% DMSO in PBS) before use. Other reagents were dissolved in DMSO.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!