The packaging construct pCMVΔR8.92 was used. The Rev gene was inserted into the pRSV-Rev plasmid to minimise the risk of recombination and the production of replication-competent lentiviruses. Viral particles were pseudotyped with the vesicular stomatitis virus G-protein encoded in the previously described pMD2.G plasmid [24 (link)]. cDNAs encoding the 2 + 3-10+1N4R isoforms of human WT Tau and mutant P301L Tau were first cloned into the Gateway Entry pCR8/GW/TOPO vector (Invitrogen) using TOPO TA cloning methodology. The Gateway LR clonase (Invitrogen) catalysed the in vitro recombination between the Gateway Entry pCR8/GW/TOPO vector (containing the Tau cDNA flanked by attL sites) and the lentiviral destination vector (containing homologous attR sites). For specific constructs, the sequence of the epitope tag V5, previously validated in vivo using immunohistochemical analysis (14 aa, GKPIPNPLLGLDST) [25 (link)], was inserted into the cDNA encoding the 2+3-10+ isoform of the human WT Tau between the sequences encoding exons two and four.
Pcr8 gw topo gateway entry vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PCR8/GW/TOPO Gateway entry vector is a cloning vector used for the Gateway cloning system. It facilitates the transfer of DNA fragments between different expression vectors. The vector contains attL1 and attL2 recombination sites, which allow for the integration of DNA inserts via site-specific recombination.
Automatically generated - may contain errors
Lab products found in correlation
Gateway technology, by Thermo Fisher Scientific (4 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (2 mentions)
Gateway lr clonase, by Thermo Fisher Scientific (1 mentions)
Gateway lr clonase 2 enzyme mix, by Thermo Fisher Scientific (1 mentions)
Tcs sp5, by Leica (1 mentions)
Plko 1 trc cloning vector, by Addgene (1 mentions)
Quikchange lightening multi site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Quikchange lightening site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Lr clonase 2 enzyme, by Thermo Fisher Scientific (1 mentions)
Pcrii topo, by Thermo Fisher Scientific (1 mentions)
Endofree plasmid maxi kit, by Qiagen (1 mentions)
Lr clonase system, by Thermo Fisher Scientific (1 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
13 protocols using pcr8 gw topo gateway entry vector
1
Lentiviral Tau Transgene Expression
2
Doxycycline-Inducible Transgene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The fragment of dCas9-KRAB was amplified from the plasmid (Addgene #50917) and introduced into Gateway Entry vector pCR8/GW/TOPO (Invitrogen, United States) following the manufacturer’s protocol and verified by sequencing. The right donor was subcloned into the destination vector p2Lox-FLAG [18 (link)] by Gateway Technology (Invitrogen).
3
Cloning and Transformation of GFP-Tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant plasmid constructs generated in this study include HAKAIpro:HAKAI-GFP, MTApro:MTA-GFP, FIP37pro:FIP37-GFP, HIZ1pro:HIZ1-GFP, and 35Spro:HIZ1-GFP. These constructs were generated by cloning the respective genomic DNA sequence (coding sequence for MTA) without the stop codon and 3′ UTR to Gateway entry vector pCR™8/GW/TOPO® (Invitrogen), then recombining into the appropriate pGreen-based GFP Gateway destination vector37 (link) using Gateway® LR Clonase™ II Enzyme Mix (Invitrogen). Transgenic lines were obtained by floral dip transformation38 (link) with the above recombinant constructs. Homozygous transgenic lines were selected and GFP-tagged protein localization in roots was determined via confocal microscopy (Leica TCS SP5). Primers used for cloning and screening were listed in Supplementary Data 9 .
4
PRMT2 Mutant Generation and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PRMT2 cDNA was amplified and introduced into Gateway Entry vector pCR8/GW/TOPO (Invitrogen) following the manufacturer’s protocol and verified by sequencing. To generate the PRMT2 mutants, we executed site-directed mutagenesis using the QuikChange MultiSite-Directed Mutagenesis Kit (Stratagene). Briefly, DpnI enzyme was added to digest the PCR product for 1 h after mutagenesis reaction, followed by transformation. The successful mutagenesis was verified by sequencing. Different constructs were subcloned in the desired vectors by Gateway technology (Invitrogen). Specific oligonucleotides against human PRMT members were cloned into pLKO.1 TRC cloning vector according to the protocol recommended by Addgene. The sequences for primers or oligos are listed in Supplementary Table 2 .
5
Cloning and Constructing p53 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
JMJD3 and UTX were cloned as previously described [11] (link). Wt p53 and p53 deletion mutants were PCR-amplified from human p53 clone [60] (link) and introduced into the Gateway Entry vector pCR8/GW/TOPO (Invitrogen) following the manufacturer's protocol. The different constructs were subcloned in the desired vectors by Gateway technology (Invitrogen).
6
Cloning of dCas9-KRAB Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The fragment of dCas9-KRAB was amplified from the plasmid (Addgene #50917) and introduced into Gateway Entry vector pCR8/GW/TOPO (Invitrogen) following the manufacturer's protocol and verified by sequencing. The right donor was subcloned into the destination vector p2Lox-FLAG [18] (link) by Gateway technology (Invitrogen).
7
Generating Mutant Chicken KRT5 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used PCR to clone chicken KRT5. We applied the QuikChange Lightening Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) to generate KRT5-N183Δ (Kang et al. 2010 (link)) and KRT5-R464_A468Δ (Kemp et al. 2005 (link)) as well as the QuikChange Lightening Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to generate KRT5-V170_K191Δ (Rugg et al. 1999 (link)) (supplementary fig. S7 and table S5 , Supplementary Material online). The DNA fragments were cloned into the pCR8/GW/TOPO Gateway entry vector (Invitrogen, Carlsbad, CA) and sequenced. An LR recombination reaction was performed to transfer the cDNAs to a Gateway compatible RCASBP-Y DV vector (Loftus et al. 2001 (link)). Virus was made according to Jiang et al. (1998) and concentrated by ultracentrifugation.
8
Cloning and Overexpression of MpFRH1 in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MpFRH1 transcript sequence was amplified from wild type M. polymorpha cDNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs) in combination with gene specific primers (TCGGCACTCTCTTCTGTACA, GGCAAAGCAAATTTATTGACGGG). The resulting PCR product was recombined into the pCR8/GW/TOPO Gateway entry vector (Invitrogen). Gateway entry vectors containing the MpFRH1 transcript variants were synthesised by Life Technologies GeneArt sequence synthesis service. To create over-expression vectors for plant transformation, LR reaction was carried out between the entry vectors and the plasmid proOsACT:Gateway:term-pCam (Breuninger et al., 2016 (link)).
9
Generation of SlDof1 RNAi Tomato Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the SlDof1 RNAi plasmid, a 272-bp fragment of the SlDof1 gene (bases 556 to 827 of the full length cDNA) was amplified using the primers Dof1-RNAi-F (5′-GCTTTATACAATTCAGGTTTTCCATTTCA-3′) and Dof1-RNAi-R (5′-CAAGATCCTCCAGTACCACTTATCATCCC-3′). The PCR product was subcloned into the PCR8/GW/TOPO Gateway entry vector (Invitrogen). The cloned fragment was then transferred into the destination vector pK7GWIWG2D by the attL × attR reaction using the LR Clonase II enzyme (Invitrogen) to generate pK7GWIWG2D-SlDof1.
The SlDof1 RNAi plasmid was transformed into the A. tumefaciens stain GV3101 by electroporation, and Agrobacterium-mediated tomato transformation was performed following a previously described method (Fillatti et al. 1987 (link)). The transformed plants were selected on the basis of kanamycin resistance, and the presence of the transgene was confirmed in the T0 and T1 generation by PCR. Approximately 100 fruits from each RNAi line and the wild type were harvested for phenotypic observation.
The SlDof1 RNAi plasmid was transformed into the A. tumefaciens stain GV3101 by electroporation, and Agrobacterium-mediated tomato transformation was performed following a previously described method (Fillatti et al. 1987 (link)). The transformed plants were selected on the basis of kanamycin resistance, and the presence of the transgene was confirmed in the T0 and T1 generation by PCR. Approximately 100 fruits from each RNAi line and the wild type were harvested for phenotypic observation.
10
Cloning and Subcloning for Drosophila Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the generation of pUAST and pUAST.attB constructs, cDNA fragments were first cloned into pCRII-TOPO (Invitrogen, Carlsbad, CA, USA), sequenced, and subcloned into destination vectors using the appropriate restriction enzymes. For the generation of pUASg-HA.attB vectors, cDNA fragments were cloned into the pCR8/GW/TOPO Gateway Entry vector (Invitrogen), sequenced, and subcloned into pUASg-HA.attB via Clonase II-mediated enzymatic transfer (Invitrogen). Before injection into Drosophila embryos, plasmid constructs were purified from liquid cultures of One Shot TOP10 E. coli using the EndoFree Plasmid Maxi kit (Qiagen, Venlo, Netherlands).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!