The largest database of trusted experimental protocols

Sybr green quantitative rt qpcr kit

Manufactured by Roche
Sourced in Switzerland

The SYBR Green Quantitative RT-qPCR Kit is a laboratory reagent used for the quantitative analysis of RNA expression through reverse transcription and real-time polymerase chain reaction (RT-qPCR) methods. The kit contains the necessary components, including SYBR Green, required to perform these analyses.

Automatically generated - may contain errors

5 protocols using sybr green quantitative rt qpcr kit

1

Quantitative Analysis of Neuronal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Neuronal gene expression levels were evaluated by qPCR, using GAPDH gene as internal standard. To extract RNA, Trizol reagent (ThermoFisher, USA) was used. Total RNA was reversetranscribed into complementary DNA (cDNA) using cDNA synthesis kit (ThermoFisher, USA) following the manufacture’s protocol. PCR reaction was carried out using SYBR Green Quantitative RT-qPCR Kit (Roche, Switzerland) and a Roche real-time PCR system (LightCycler 96). ΔCt values were calculated by subtracting the GAPDH Ct value from that of target genes. Relative expression levels were calculated using the 2−ΔΔCt method. Primer sequences and the size of amplicons are listed in Table 2.
+ Open protocol
+ Expand
2

Quantitative RT-qPCR Analysis of HAND2-AS1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Trizol (Thermo Fisher Scientific) according to the instruction. Then reverse transcription was performed with superScript III Reverse Transcriptase (Thermo Fisher Scientific) and PCR reaction systems were prepared with SYBR Green Quantitative RT-qPCR Kit (Roche) according to the instructions. All primers used in this study were purchased from Sangon and as follows:
HAND2-AS1 Forward: Forward: 5′-GGAGTCACAGGCAGTCGTAGA-3′
HAND2-AS1 Reverse: 5′-GAAGGCACAGATCATTCATGG-3′
β-actin Forward: 5′-TTCCAGCCTTCCTTCCTGGG-3′
β-actin Reverse: 5′-TTGCGCTCAGGAGGAGCAAT-3′
+ Open protocol
+ Expand
3

Evaluating BAPTA's Impact on Apoptosis-Related Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
To confirm the effect of BAPTA on apoptosis related gene expression, 40 μM of BAPTA were applied for 30 minutes after bead rolling. After 12 hours, damaged neurons were collected for the qPCR. GAPDH gene was used as an internal standard. To extract the RNA, trizol reagent (Thermo Fisher) was used. Total RNA was reverse‐transcribed into complementary DNA (cDNA) using the cDNA synthesis kit (Thermo Fisher) following the manufacture's protocol. PCR reaction was carried out using the SYBR® Green Quantitative RT‐qPCR Kit (Roche, Switzerland) and a Roche real‐time PCR system (LightCycler® 96). ΔCt values were calculated by subtracting the GAPDH Ct value from that of target genes. Relative expression levels were calculated using the 2−ΔΔCt method. Primer sequences and the size of amplicons are listed in Table 1.
+ Open protocol
+ Expand
4

Quantitative RT-qPCR Analysis of FER1L4

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Trizol reagent (Thermo Fisher Scientific) was used to extract total RNA in plasma and synovial fluid following the manufacturer’s protocols. SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) was used to construct cDNA through while SYBR Green Quantitative RT‐qPCR Kit (Roche) was employed for PCR, following the specified protocols. The primer sequences used for the PCR were as follow:
FER1L4 Forward: 5'-TCACAGACATGGGTGGCAATG -3’,
FER1L4 Reverse: 5'- GGGTTCACAAACCAGTTGAAGG -3';
β-actin Forward: 5'-TTCCAGCCTTCCTTCCTGGG-3',
β-actin Reverse: 5'-TTGCGCTCAGGAGGAGCAAT-3'.
+ Open protocol
+ Expand
5

Comprehensive RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Trizol (Thermo Fisher Scienti c) according to the instruction. Then reverse transcription was performed with superScript III Reverse Transcriptase (Thermo Fisher Scienti c) and PCR reaction systems were prepared with SYBR Green Quantitative RT-qPCR Kit (Roche) according to the instructions. All primers used in this study were purchased from Sangon and as follows: HAND2-AS1 Forward: Forward: 5'-GGAGTCACAGGCAGTCGTAGA -3', HAND2-AS1 Reverse: 5'-GAAGGCACAGATCATTCATGG -3'; β-actin Forward: 5'-TTCCAGCCTTCCTTCCTGGG-3', β-actin Reverse: 5'-TTGCGCTCAGGAGGAGCAAT-3'.
Enzyme-linked immunosorbent assay (ELISA) IL-6 Human ELISA Kit (Thermo Fisher Scienti c) was used to detect the IL-6 level in plasma according to the instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!