Transfections and viral infections were performed as previously described40 (link). For acute analysis of gene expression changes, RNA was isolated from GFPhigh cells FACS-sorted 48 hours after transfection with MigR1-N1ICD or Rest-IRES-GFP or the empty vector control. Viral transductions of N1ICD or Rest were used to generate adherent non-NE cells from NE cells, a process which takes about 1–2 weeks. The cells were then expanded and collected for immunoblot analyses. For isolation of Rest-knockout clones, sgRNA-infected cells were selected with puromycin (2 μg/ml) for 4 days and single cells were sorted into individual wells in 96-well plates by FACS. After two weeks, clones were picked and clones with biallelic frameshift mutations resulting in premature truncation of the translated protein were verified by TOPO® PCR cloning (Thermo Fisher Scientific) and Sanger sequencing.
Topo pcr cloning
Manufactured by Thermo Fisher Scientific
Sourced in United States
TOPO® PCR cloning is a molecular biology tool designed for the rapid and efficient cloning of PCR amplified DNA fragments. It utilizes topoisomerase I-mediated ligation to facilitate the direct insertion of PCR products into a vector, without the need for restriction enzyme digestion or ligation. The core function of this product is to provide a streamlined method for the cloning of PCR amplified DNA segments.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using topo pcr cloning
1
Workflow for Assessing Transcriptional Regulation
2
Workflow for Assessing Transcriptional Regulation
3
DNA Extraction and Mutation Analysis
4
DNA Extraction and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted with 50 mM NaOH from yolk sacs and PCR-amplified using forward and reverse primers (Supplementary Table 12 ): p.(Ile226Thr)-F, p.(Ile226Thr)-R, p.(Ala321Pro)-F, p.(Ala321Pro)-R, with the expected product sizes of 455 bp for the p.(Ile226Thr) amplicon and 422 bp for the p.(Ala321Pro) amplicon. PCR products were then submitted for Sanger sequencing. For some embryos, the PCR products were subcloned using TOPO PCR cloning (Life Technologies, Inc.), with multiple clones analyzed per embryo by Sanger sequencing.
5
Subcellular Localization of AtKRP125b
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A GFP-fusion construct was generated by cloning AtKRP125b from cDNA into pMDC43 using TOPO-PCR cloning (Invitrogen). Protoplasts from Arabidopsis thaliana mesophyll cells were prepared as previously described [49 (link)] and transformed, using 20 ng of plasmid DNA. Additionally, the construct was inserted into A. tumefaciens C58C1 and then transformed into N. benthamiana leaves [50 (link)]. These procedures were repeated 3 times. All imaging of subcellular localization was captured with a confocal laser scanning microscope (TCS SP8, Leica, Wetzlar, Germany). GFP fluorescence was visualized using an argon laser at 488 nm for excitation and an emission window of 502–512 nm. Hoechst 33342 was visualized with an excitation of wavelength of 405 nm and an emission window of 445–465 nm, whereas chlorophyll autofluorescence was detected in an emission window of 660–675 nm.
6
Cloning of AtKRP125b-promoter GUS construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cloning of the AtKRP125b-promoter GUS construct we amplified 847 bp in front of the start codon of AtKRP125b from genomic DNA by PCR with primers Kin5_GUS-fw (CACCGTGTTTCCTAGCCTTCTTTT) and Kin5_GUS-rev (GAACGGACGGCGAATCCAGTGAGA) and cloned the derived fragment into pMDC163 using TOPO PCR-Cloning (Invitrogen, Waltham, MA, USA). Agrobacteria tumefaciens C58C1 cells were transformed with this plasmid and painted onto flowers and buds of Arabidopsis thaliana plants as previously described [47 (link)]. Transformed offspring was identified by hygromycin selection [48 (link)]. We identified five independent GUS-positive plant lines that showed a distinct signal after staining in X-Gluc solution for 90 min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!