Primepcr probe assay
The PrimePCR™ Probe Assay is a real-time PCR assay designed for the detection and quantification of target DNA sequences. The assay utilizes fluorescent probes to monitor the amplification of specific gene targets during the PCR process. The core function of the PrimePCR™ Probe Assay is to provide a reliable and efficient method for gene expression analysis in research applications.
Lab products found in correlation
17 protocols using primepcr probe assay
Quantifying mRNA Expression in Muscle Biopsies
Analyzing Immune Cell Infiltration in Chicken Tumor Samples
Gene Expression Analysis of Fibroblast Markers
Includes the reference information for the genes used in the detailed qPCR analyses.
Primer | Sequence |
---|---|
uPA (PLAUR) | Bio-Rad Prime PCR Probe Assay: Cy5 Fluorophore, qHsaCIP0031103 |
uPA (PLAU) | Bio-Rad Prime PCR Probe Assay: Cy5.5 Fluorophore, qHsaCIP0032518 |
LRP1 | ACATATAGCCTCCATCCTAATC GCTTATACCAGAATACCACTC |
α-SMA (ACTA2) | Bio-Rad Prime PCR Probe Assay: FAM Fluorophore, qHsaCIP0028813 |
GUSB | Bio-Rad Prime PCR Probe Assay: HEX Fluorophore, qHsaCIP0028142 |
Quantitative PCR Analysis Protocols
Multiplex qRT-PCR Analysis of Lacrimal Gland Development
Subsequently to cDNA synthesis, reverse transcription PCRs for Aquaporin 1, 5, and 8 were performed using an annealing temperature of 60°C for 40 cycles. One hundred fifty nanograms of total RNA was used for each reaction.
The primer sequences are given in the following table:
Multiplex qRT-PCRs (CFX96 Touch™ Real-Time PCR Detection System, Bio-Rad) were performed using iTaq universal probe super mix (Bio-Rad, 1725130). Ten nanograms of cDNA were used per reaction. Probe combinations (PrimePCR Probe Assay, Bio-Rad):
Combination 1: GAPDH-Cy5 (qMmuCEP0039581); Krt14-Hex (qMmuCEP0058885); Acta2-Cy5.5 (qMmuCIP0032840); Krt19-FAM (qMmuCIP0033699).
Combination 2: GAPDH-Cy5 (qMmuCEP0039581); Notch2-Hex (qMmuCIP0030263); Hey1-Tex615 (qMmuCEP0057542).
Combination 3: GAPDH-Cy5 (qMmuCEP0039581); Hey1-Tex615 (qMmuCEP0057542); Krt14-Hex (qMmuCEP0058885); Acta2-Cy5.5 (qMmuCIP0032840).
Quantitative Analysis of Inflammatory Cytokines in Mouse Tissues
Quantifying Inflammatory Cytokine Profiles in Murine Tissues
Prefrontal Cortex Gene Expression Changes
Quantifying Inflammatory Cytokine mRNA in Mice
Quantitative Analysis of Bone Metabolism Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!