Pegfp n2 vector

RdxT564D and RdxT564A were generated using a site-directed mutagenesis kit (Stratagene, LaJolla, CA) and cloned as XhoI—KpnI fragments into pEGFP-N2 vector (BD Bioscience, Heidelberg, Germany) or as KpnI–SacI fragments into pBK-CMV-myc (Stratagene). To integrate RdxT564A–green fluorescent protein (RdxT564A–GFP) in the pdsAAV-TNNT2 transfer plasmid, the DNA was amplified from the previously generated pEGFP-N2-RdxT564A construct using primer pairs containing SalI–XhoI sites (5′- ATCCTCTAGAGTCGACATGCCGAAGCCAATCAATGTAAGAG -3′; 5′- CCGTAGATCTCTCGAGTTACTTGTACATCTCGTCCATGC -3′). Rdx-WT–GFP–pAAV was generated by subcloning Rdx-WT-pEGFP-N2 as HindIII–KpnI fragment into the previously generated RdxT564A–GFP–pAAV vector. The following constructs have been previously described: pGEX-5X-1-GABA_AR-α5 TMIII-TMIV intracellular loop7 (link), pGEX-5X-1-GABA_AR-α2 TMIII-TMIV intracellular loop3 (link), pEXV-RhoN19, pEXV-RhoV14 and pEXV-RacV12 (ref. 25 (link)). All constructs were verified by dideoxy sequencing.

All constructs for imaging were cloned into the standard peGFP-N2 vector (BD Biosciences Clontech, Heidelberg, Germany). Constructs used for planar lipid bilayer experiments were cloned into pET24-dellac (Merck, Darmstadt, Germany). Fragments were amplified with relevant overhangs using either Phusion polymerase (Thermo Fisher, Langenselbold, Germany) or Q5 polymerase (NEB, Frankfurt am Main, Germany) according to manufacturer’s specifications. The fragments were subsequently fused by either overlap-extension PCR [23 (link)] or Gibson Assembly [24 (link)]. The correct construct size was checked by standard agarose-gelelectrophoresis. Bands showing the expected size were purified with the Zymoclean Gel DNA Recovery Kit (Zymo Research, Freiburg, Germany) and the purified DNA was taken for heat shock transformation in competent Escherichia coli (DH5α). The amplified plasmid DNA was extracted with the ZR Plasmid Miniprep Kit Classic (Zymo Research, Freiburg, Germany) and sent sequenced (Microsynth Seqlab, Göttingen, Germany).

pEGFP-Spem2 vector was constructed by amplifying the entire open reading frame (ORF) of Spem2 gene and cloned into the BglII/EcoRI sites of pEGFP-N2 vector (BD Biosciences, USA). pFLAG-Spem2 vector was constructed by amplifying its whole ORF and cloned into the HindIII/BglII sites of pFLAG-CMV-4 (Sigma-Aldrich, USA). pcDNA3.1-Prss21-HA vector was constructed by amplifying its ORF as well as HA sequence, and cloned into the HindIII/EcoRI sites of pcDNA3.1 ( +) vector (Invitrogen, USA). The eukaryotic expression plasmids including pEGFP-Prss55, pCAG-Adam2-FLAG, pCAG-Clgn-FLAG, pCAG-Pdilt-FLAG, pCAG-Adam3-Myc, pCAG-Prss54-HA and pCAG-Zpbp-FLAG have been reported before [20 (link), 21 (link), 50 (link)]. The HEK293T cells, which were originally purchased from ATCC (Manassas, VA, USA) and maintained in our laboratory, were cultured in high glucose DMEM medium (Gibco) containing 10% FBS at 37 °C with 5% CO₂. The recombinant plasmids were transfected into cells using Lipofectamine 3000 transfection reagent (Invitrogen). Cells were harvested 48 h after transfection and used for subsequent analysis of the interaction of SPEM2 and other proteins.