The extracted DNA was amplified using primers (targeting V1-V3 region of the 16S rRNA gene) with adapters (forward: 5′-adapter [TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAG]-GAGTTTGATCMTGGCTCAG-3′; reverse: 5′-adapter [GTCTCGTGGGCTCGGAGATGTGTATAAGAG ACAG]-ATTACCGCGGCTGCTGG-3′). PCR amplification followed preparation of a 16S metagenomics sequencing library for the MiSeq system (Illumina, Inc., San Diego, CA, United States) was performed as described previously (Lee et al., 2017 (link); Kim et al., 2019 (link)). The library was quantified using a PCR Thermal Cycler Dice Real-Time System III (Takara Bio.) with the GenNext NGS Library Quantification Kit (Toyobo, Osaka, Japan). Equimolar concentrations of each library from the different samples were pooled and sequenced using an Illumina MiSeq system (300 bp-paired ends), following the manufacturer’s instructions.
Gennext ngs library quantification kit
Manufactured by Toyobo
Sourced in Japan
The GenNext NGS Library Quantification Kit is a laboratory equipment product designed for the quantification of next-generation sequencing (NGS) libraries. It provides a reliable and accurate method for determining the concentration of DNA libraries prior to sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (3 mentions)
Miseq system, by Illumina (2 mentions)
Nextseq 500, by Illumina (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Pcr thermal cycler dice real time system 3, by Takara Bio (1 mentions)
Human cot 1 dna, by Thermo Fisher Scientific (1 mentions)
Nextseq 500 kit, by Illumina (1 mentions)
Miseq reagent kit v3, by Illumina (1 mentions)
2200 tapestation system, by Agilent Technologies (1 mentions)
Truseq stranded mrna library kit, by Illumina (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Rna 6000 nano kit, by Agilent Technologies (1 mentions)
Agilent high sensitivity dna kit, by Agilent Technologies (1 mentions)
Nebnext ultra 2 dna library prep kit, by New England Biolabs (1 mentions)
Nextseq 500 platform, by Illumina (1 mentions)
Nebnext ultra dna library prep kit for, by Illumina (1 mentions)
Agarosagencourt ampure xp, by Beckman Coulter (1 mentions)
Novaseq 6000, by Illumina (1 mentions)
Glycogen, by Thermo Fisher Scientific (1 mentions)
8 protocols using gennext ngs library quantification kit
1
16S rRNA Amplicon Sequencing
2
Enrichment and Sequencing of Viral DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the enrichment of viral fragments contained in the synthesized libraries, several libraries were pooled to perform the capture step, as described before31 (link). Briefly, the pooled libraries were mixed with the virus-specific probes in the presence of human Cot-1 DNA (Invitrogen) and xGen universal blocking oligos (IDT) for the hybridization step. A series of wash steps were performed using DNA xGen lockdown reagents (IDT), following the manufacturer’s recommendations. The quality of the enriched DNA libraries was evaluated by electrophoresis with a TapeStation 2200 system (Agilent Technologies) and quantified by real time PCR with the GenNext NGS library quantification kit (Toyobo). Finally, the multiplexed libraries were subjected to cluster generation using a MiSeq Reagent Kit v3 (150 cycles) or NextSeq 500 Kit (75 cycles) in MiSeq or NextSeq desktop sequencing systems (Illumina), respectively.
3
RNA Isolation and Sequencing from Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quality and quantity of isolated RNA from macrophages were assessed using a Nanodrop 1,000 Spectrophotometer or Qubit 3.0 Fluorometer (Thermo Fisher Scientific) and an RNA 6000 Nano Kit on an Agilent 2,100 Bioanalyzer (Agilent Technologies). Two micrograms of total RNA with an RNA integrity number (RIN) greater than 7 was used to construct cDNA libraries using a TruSeq Stranded mRNA library kit (Illumina). All cDNA libraries were checked for quality using a DNA 1000 Kit on an Agilent 2,100 Bioanalyzer and quantified with a Qubit 3.0 Fluorometer and a GenNext NGS Library Quantification Kit (Toyobo). The libraries were sequenced on an Illumina NextSeq 500 to generate more than 25 million 75 base-long paired-end reads per library. Raw sequence data have been deposited in the DRA database under the accession number DRA014120.
4
ChIP-seq Library Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed as described in “ChIP qRT-PCR&". Library preparation was conducted with NEBNext Ultra II DNA Library Prep Kit (New England Biolabs #E7645L) for Illumina according to manufactured protocol. After PCR step, size distribution and yield of the library was determined by Agilent High Sensitivity DNA kit on the bioanalyzer (Agilent #5067-5583). qRT-PCR was conducted for determining of library concentration using GenNext NGS Library Quantification Kit (TOYOBO #NLQ-101). The pooled libraries were loaded on the Illumina Nextseq500 platform and analyzed by 75bp single read.
5
Detailed DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from the samples using protease K cleavage combined with the phenol chloroform extraction method (Sambrook and Russell, 2006 ). DNA purity was verified by running the samples on 1.2% agarose gels. The DNA concentration was determined using a Qubit Fluorometer (Thermo Fisher, Waltham, MA, United States). Extracted DNA was sheared on a Covaris M220 (Covaris, Woburn, MA, United States) programmed to generate 300-bp fragments. The sequencing libraries were constructed with a NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB, Ipswich, MA, United States). The products were purified using AgarosAgencourt AMPure XP (Beckman, Brea, CA, United States) and quantified using the GenNext™ NGS Library Quantification Kit (Toyobo, Japan). The libraries were sequenced using an Illumina NovaSeq 6000 and 150-bp paired-end technology.
6
PCR-free Sequencing Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eluted PCR-free captured libraries (25 μL) were mixed with equal volume of 0.2 N NaOH and allowed to stand for 3 min at room temperature to separate the capture probes. After the released probes were removed with magnetic beads, the supernatant containing the single-stranded PCR-free libraries was neutralized with 50 μL of 200 mM Tris-HCl (pH 7.5). Next, 5 μg of glycogen (Thermo Fisher Scientific) was added to the collected PCR-free captured libraries as a co-precipitant. The libraries were precipitated by adding 100 μL of isopropyl alcohol and the obtained pellet was washed once with 70% ethanol and then dissolved in 35 μL or 15 μL RNase-free water for PCRfree-Soni and PCRfree-Frag, respectively. Library quantification was conducted by qPCR with GenNext NGS library quantification kit (TOYOBO, Japan). The libraries were directly mixed with another 10 pM UMI or non-UMI library diluted with HT1 buffer. All libraries were sequenced on an Illumina HiSeq 2500 system performing 100 bp paired-end reads. The raw data were deposited in the DNA Data Bank of Japan (DDBJ; accession nos. DRA008877, PRJDB8701).
7
ChIP-seq Protocol for Epigenetic Profiling
8
16S rRNA Microbiome Profiling from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metagenomic DNA was extracted from fecal samples of subjects using the RNeasy Power Microbiome kit following the company's instructions (Qiagen, Valencia, CA, USA). The extracted DNA was purified using the DNeasy PowerClean Pro Cleanup Kit (Qiagen, Valencia, CA, USA). DNA in each sample was amplified with adaptor primers targeting the V1-V3 region of the 16S rRNA gene. PCR amplification was performed according to the protocol for preparing a 16S metagenomics sequencing library with the MiSeq system (Illumina, Inc., San Diego, CA, USA). After amplification, PCR products were verified with a 2% agarose gel electrophoresis, and amplicons of target size were selected and purified using AMPure XP bead (Beckman Coulter, Brea, CA, USA). The purified amplicon library was quantified using the TaKaRa PCR Thermal Cycler Dice Real Time System III with the GenNext NGS Library Quantification kit (Toyobo, Osaka, Japan). Equimolar concentrations of each library were pooled and sequenced using the Illumina MiSeq system (300bp paired end).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!