Human SBDS protein wild-type, mutants, truncated constructs, and combinations thereof, as well as the yeast SBDS orthologue (Sdo1), were expressed from a pRSET (ThermoFisher Scientific) plasmid in Escherichia coli C41 and purified by conventional chromatographic techniques as described in References [10 (link),21 (link)]. Human SBDS and yeast Sdo1 truncated constructs, and combinations thereof, corresponded to domain 1—residues 1–94, domain 2—residues 94–175, domains 1–2—residues 1–174, and domain 2–3—residues 94–250. For the anisotropy experiments, human SBDS and all the variants tested were modified to encode for a C-terminal FlAsH tag corresponding to residues Cys–Cys–Pro–Gly–Cys–Cys. Yeast and human EFL1 were expressed in S. cerevisiae BCY123, using the backbone of the pRS426 vector under the control of the GAL1/10 promoter and the 3’UTR MATA, and were purified as described in Reference [21 (link)]. The expressed GTPases consist of the corresponding protein fused to a TEV recognition site and a hexahistidine tag at the C-terminus.
Prset
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PRSET is a versatile laboratory equipment designed for general laboratory use. It provides a reliable and consistent solution for a variety of applications. The core function of the PRSET is to perform essential laboratory tasks with precision and efficiency.
Automatically generated - may contain errors
Lab products found in correlation
Histrap hp 1 ml column, by GE Healthcare (1 mentions)
E coli bl21 de3 cells, by New England Biolabs (1 mentions)
Prseta, by Thermo Fisher Scientific (1 mentions)
Bl21 de3 plys, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Takara Bio (1 mentions)
Pgex 6p 1, by GE Healthcare (1 mentions)
Egg lecithin, by BOC Sciences (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
10 protocols using prset
1
Purification and Characterization of SBDS Protein Constructs
2
Purification and Labeling of BRET Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BRET-protein overexpression plasmids were constructed by cloning genes into pRSET (ThermoFisher Scientific) using standard techniques. His-tagged BRET proteins were expressed in E. coli BL21 (DE3) cells (New England Biolabs, USA) and purified from lysates using HisTrap HP 1 mL columns integrated into an ÄKTAxpress Fast Performance Liquid Chromatography system (GE Healthcare, Australia), dialysed against 50 mM Tris (pH 8), 50 mM NaCl at 4 °C, snap-frozen and stored at −80 °C. Their purity was analysed by SDS-PAGE (Fig. S1 ). HaloTag-containing purified proteins were labelled by incubating 100 nM protein stocks (diluted in phosphate buffered saline (PBS; 10 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.4)) containing 2 μM TMR or 0.4 μM NCT at 30 °C for 1 h before BRET analyses. For detailed experimental details see the supplementary information.
3
Comprehensive Expression Construct Database
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EE4-luc reporter and the following expression constructs in the RactHAdh vector (or Ract for short) have been described in previous publications: myc-GFP, Gro, myc-m7, myc-EQRQTKHQ, mγ, mδ, His-Da, Xpress-Ubi (45 (link),66 (link)–68 (link)). The 3xmyc-pBS vector was used as the basis for myc-tagging all expression constructs and is described in detail in the Supplementary Materials. Each myc-tagged gene was originally constructed by cloning the open reading frame (ORF) of the gene into the 3xmyc-pBS vector, sequence verification and subsequent subcloning into Ract vector for tissue culture expression (list of these plasmids in supplementary data). For Ract-His a sequence derived from pRSET (Invitrogen) ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCT AGC was inserted to Ract (encoding the peptide MRGSHHHHHHGMASSRPAGMQAI RCTLTFFS). All His tagged genes were constructed by inserting the coding sequence of the gene into Ract-His vector. For HA-m7 in Ract a sequence encoding MYPYDVPDYA GIPLEF was appended to the 5′ end of the m7 variants and inserted into Ract. Luciferase and lacZ were cloned by PCR into Ract vector (Ract-luc and Ract-lacZ plasmids).
For transgenesis 3xmyc-tagged constructs of Sc[RQEQ], Sc[m3p], Sc[1320] and Sc[m5p] were subcloned into pUAST (69 (link)).
More detailed description of all new constructs can be found in the Supplementary Materials.
For transgenesis 3xmyc-tagged constructs of Sc[RQEQ], Sc[m3p], Sc[1320] and Sc[m5p] were subcloned into pUAST (69 (link)).
More detailed description of all new constructs can be found in the Supplementary Materials.
4
Cloning and Expression of CTB-INS Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA sequence encoding 258bp of the human proinsulin gene (INS M12913.1) was linked to the carboxyl-terminus of a DNA fragment (309bp) encoding the cholera toxin B subunit gene (CTB U25679.1) to generate the fusion gene CTB-INS. Four GpGp sequences were inserted between the two genes to promote molecular flexibility [28 (link)]. The CTB-INS fusion gene was cloned into E. coli expression vector PBR-322 and the plasmid amplified in E. coli HB101 [29 (link)]. To achieve high levels of transgene expression, the CTB-INS gene fusion was subcloned into E. coli expression vector pRSET-A (Invitrogen, Carlsbad, CA) under control of the bacteriophage T7 promoter [23 (link)]. The resultant bacterial expression vector (pRSET-CTB-INS) contains an oligonucleotide encoding 6 contiguous histidines located immediately upstream of CTB-INS to permit nickel affinity column isolation of the recombinant fusion protein. Expression vector pRSET-CTB-INS was transformed into the E. coli producer strain BL21 (DE3) pLysS (Invitrogen, Carlsbad, CA) for production and isolation of milligram amounts of the CTB-INS protein for further experiments [29 (link)].
5
Recombinant Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Open reading frame fragment of d4h-like cDNA amplified with high-fidelity Taq DNA polymerase (TaKaRa) was fused into the pRSET (Invitrogen) vector and confirmed by sequencing. The vector was transferred into E. coli strain BL21 (DE3) to express the proteins according to the direction for pRSET kit. Water-soluble recombinant proteins were separated with SDS-PAGE electrophoresis.
6
Cloning and Mutagenesis of vbp and virD2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains and plasmids used are given in Table S3 . Intact vbp and vird2 genes were amplified from A. tumefaciens C58 plasmid and Ti plasmid, respectively. These genes were then cloned to pET32a (Novagen; Madison, WI, USA) and pRSET (Invitrogen, Carlsbad, CA, USA) vectors, respectively. N-terminal nucleotidyltransferase (NT) domain and C-terminal HEPN domain constructs were created using specific primers that amplify these regions and were cloned into pGEX-6p1 (GE Healthcare; Buckinghamshire, UK). Site-specific mutations in vbp were introduced by overlapping PCR, as described previously [26] (link). Each construct was verified by DNA sequencing. A fragment of virF cassette cloned from pTiBo542 (GenBank: DQ058764.1) was inserted into the SphI–ApaI site on pCB301 [27] (link). The virF coding sequence was substituted with a multiple cloning site, resulting in pQH300.
7
Recombinant PTD-BMP2 Production and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant PTD-BMP2 was synthesized as previously described.11 (link)
The PTD-fusion BMP2 polypeptide was amplified using pRSET (Invitrogen, Waltham, MA, USA), a bacterial expression vector containing an Xpress epitope and a His tag. The precursor cDNA of BMP2 was amplified from the cDNA of Saos-2 osteosarcoma cells using polymerase chain reaction. The TAT sequences (RKKRRQRRR) for the PTD domain were inserted adjacent to the epitope, and the precursor cDNAs of BMP2 were cloned into a TAT-expression cassette. Following the transformation of BL21 competent cells and IPTG induction, inclusion bodies were obtained from the insoluble fraction using 1% Triton X-100 buffer. The insoluble fraction was solubilized with an 8 M urea solution, and the recombinant protein was purified using Ni-Ti beads and imidazole elution. Buffer shock was then employed to imbue high surface energy (∆G) properties. Denatured polypeptides were micellized with filtered 0.1% egg lecithin (BOC Sciences, Shirley, NY, USA) via bath sonication.28 (link),29 (link)
The PTD-fusion BMP2 polypeptide was amplified using pRSET (Invitrogen, Waltham, MA, USA), a bacterial expression vector containing an Xpress epitope and a His tag. The precursor cDNA of BMP2 was amplified from the cDNA of Saos-2 osteosarcoma cells using polymerase chain reaction. The TAT sequences (RKKRRQRRR) for the PTD domain were inserted adjacent to the epitope, and the precursor cDNAs of BMP2 were cloned into a TAT-expression cassette. Following the transformation of BL21 competent cells and IPTG induction, inclusion bodies were obtained from the insoluble fraction using 1% Triton X-100 buffer. The insoluble fraction was solubilized with an 8 M urea solution, and the recombinant protein was purified using Ni-Ti beads and imidazole elution. Buffer shock was then employed to imbue high surface energy (∆G) properties. Denatured polypeptides were micellized with filtered 0.1% egg lecithin (BOC Sciences, Shirley, NY, USA) via bath sonication.28 (link),29 (link)
8
Cloning and Mutagenesis of Leptospira Loa22 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The loa22 gene (LSS_RS00795;
591 bp) was cloned from pathogenic L.
santarosai serovar Shermani genomic DNA using pfu-Turbo DNA polymerase
(Stratagene, La Jolla, CA)23 (link). The primers used for loa22 gene construction were listed in Table1 . After restriction enzyme double digestion, the PCR
product was individually inserted into the expression vector pRSET (Invitrogen,
Groningen, Netherlands). The point mutation of loa22 variants were obtained by using Q5 Site-Directed Mutagenesis
Kit (NEB, Ipswich, MA) with their relevant primers listed in Table1 . The plasmid DNA was verified by DNA
sequencing.
591 bp) was cloned from pathogenic L.
santarosai serovar Shermani genomic DNA using pfu-Turbo DNA polymerase
(Stratagene, La Jolla, CA)23 (link). The primers used for loa22 gene construction were listed in Table
product was individually inserted into the expression vector pRSET (Invitrogen,
Groningen, Netherlands). The point mutation of loa22 variants were obtained by using Q5 Site-Directed Mutagenesis
Kit (NEB, Ipswich, MA) with their relevant primers listed in Table
sequencing.
Primers used in this study.
| Genes | Forward (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| TNF-α | ATGAGCACAGAAAGCATGATCCGC | CCAAAGTAGACCTGCCCGGACTC |
| CXCL8/IL-8 | ATGACTTCCAAGCTGGCCGTGGCT | TCTCAGCCCTCTTCAAAAACTTCTC |
| CCL2/MCP-1 | CCGCTGTTATAACTTCACC | ACATCCCAGGGGTAGAACTG |
| hTLR2 | CGACGCGTAGCATGCCACATAC | GCACGCGTGGACTTTATCGCA |
| Loa22WT | GGATCCATGGTCAAAAAAATTTTG | AAGCTTTTATTGTTGTGGAGC |
| Loa22D122A | CCGGACACACCGCTGCTATCGGACCC | GGGTCCGATAGCAGCGGTGTGTCCGG |
| Loa22R143A | CTTTTATTCCGAACTTGCTGCAAATGCCG | CGGCATTTGCAGCAAGTTCGGAATAAAAG |
9
Cloning of 47 kDa OMPOT Ag from Boryong
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pair of primers (forward primer: 5′-GTGGATCCATGGTATTACCTCAACAAAAATC-3′, reverse primer: 5′-GTCTCGAGTTACTTATTAATATTAGGTAAAGC-3′) were designed for the cloning of 47 kDa Ag from OMPOT Boryong strain. The coding sequence for amino acids from 31 to 466 of OMPOT was amplified by PCR, using genomic DNA purified from O. tsutsugamushi Boryong strain using QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). The PCR product was digested with BamH1 and Xho I and inserted into the bacterial expression vector pRSET (Invitrogen). The final sequence was confirmed by PCR and DNA sequencing.
10
Engineered Optical Sucrose Sensors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs of pRSET (Invitrogen) carrying S208F, V224L in Cer, S208F, V224L in Aph and D192N, W283A W283G, W283C, W283L, W283I and W283V, respectively in ThuE were designed by site-directed mutations in optical sucrose sensors by using the QuickChange II Site-Directed Mutagenesis (SDM) Kit (Agilent Technologies) following the manufacturer's instructions. Nanosensor sequences were confirmed by DNA sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!