Genomic DNA was isolated from roots using a Plant DNeasy Kit (Qiagen). A total of 40 ng of genomic DNA served as the template in qRT-PCR using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich) in a Stratagene Mx3005P Real-time PCR Detection System (Agilent Technologies) following the manufacturer’s recommended protocol. The 2−ΔCt method (Schmittgen and Livak, 2008 (link)) was used to determine the extent of fungal colonization by subtracting the raw cycle threshold values of S. indica internal transcribed spacer from those of Arabidopsis UBQ5 (for primer sequences, see Supplemental Table 5 ). Differences in S. indica colonization were determined by Student’s t test.
Stratagene mx3005p real time pcr detection system
Manufactured by Agilent Technologies
Sourced in Germany, United States
The Stratagene Mx3005P Real-time PCR Detection System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qPCR) analysis. It provides the capability to perform real-time monitoring of nucleic acid amplification and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green jumpstart taq readymix, by Merck Group (2 mentions)
Quick rnatm miniprep kit, by Zymo Research (2 mentions)
Dneasy plant kit, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Qscript cdna synthesis kit, by Quanta Biosciences (1 mentions)
Power sybr green rna to ct 1 step kit, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Takara Bio (1 mentions)
6 protocols using stratagene mx3005p real time pcr detection system
1
Quantifying Fungal Colonization in Arabidopsis
2
Gene Expression Analysis of Plant Roots
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression analyses of whole roots, root material was harvested 2 and 24 h after flg22, Pep1, or control treatment. TRIzol (Invitrogen) was used to extract total RNA. After DNase treatment, RNA was reverse transcribed into cDNA using a qScript cDNA synthesis kit (Quanta Biosciences), and 10 ng of cDNA was used as a template in qRT-PCR using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich) and a Stratagene Mx3005P Real-time PCR Detection System (Agilent Technologies) following the manufacturer’s recommended protocol. The 2−ΔCt method (Schmittgen and Livak, 2008 (link)) was used to determine the differential expression of marker genes for immunity activation, and the housekeeping genes UBIQUITIN5 (UBQ5, AT3G62250) and ELONGATION FACTOR1α (EF1α, AT5G60390; for primer sequences, see Supplemental Table 5 ) were used for normalization. Data were analyzed using Student’s t test.
3
Quantifying mRNA Expression in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using the Quick-RNATM MiniPrep kit (Zymo Research, Orange, California, USA), followed by qRT-PCR with the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems, Foster City, California, USA) 48 h after transfection. Specifically, primers purchased from QIAGEN (Hilden, Germany) were used to perform qRT-PCR using the Stratagene Mx3005P Real-Time PCR detection system (Agilent Technologies, Santa Clara, California, USA). All experiments were normalized with β-actin as an internal control.
4
Quantitative RNA Expression Analysis
5
Real-Time PCR Assay for Sensitive DNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each 25 μl volume reaction contained 1x reaction buffer, 200 μM dNTPs, 1 mM MgCl 2 , 1 U Taq DNA polymerase (Thermo Scientific), 0.2 μM TaqMan probe, 500 ng of DNA template, and pair of specific primers with a 10-fold concentration difference of one of the primers (0.04 μM/0.4 μM). Real-time PCR protocol started with a denaturation step for 3 min at 95°C, followed by 55 cycles at 95°C for 30 s, 61°C for 30 s, and 72°C for 20 s, and fluorescence acquisition at 62°C. The MxPro-Mx3000P software (version 4) was used to collect and analyze amplification and melting data from the Stratagene Mx3005P real-time PCR detection system (Agilent Technologies).
6
Neurobiology of LPS and Viral Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 0, 4, 12, or 24 h post-injection of LPS and after 4 weeks of virus injection, mice were euthanized by sodium pentobarbital solution (100 mg/kg). NAc brain tissue was dissected bilaterally on ice and immediately frozen in sample tubes placed in liquid nitrogen. The tissue was stored frozen at -80 °C until processing. Next, total RNA was isolated using the TRIzol® RNA extraction kit (Invitrogen). Reverse transcription was performed using 1 µg of total RNA for each sample by using the PrimeScriptTM RT reagent kit (Takara Bio Inc.) according to the manufacturer's instructions. Real-time PCR ampli cation was performed using the Stratagene Mx 3005p Real-Time PCR Detection System (Agilent Technologies, Santa Clara, CA, USA) with SYBR Green master mix (Takara Bio Inc.) in a nal volume of 20 µL that contained 1 µL of cDNA template from each sample. The primers used in our study are listed as follows: D3R forward: CATGATTACGGCTGTGTGGG, D3R reverse: GAGGATCCGTTTTCTTCGCC; Iba1 forward: ACGAACCCTCTGATGTGGTC, Iba1 reverse: TGAGGAGGACTGGCTGACTT; GAPDH forward: TGTGTCCGTCGTGGATCTGA; GAPDH reverse: TTGCTGTTGAAGTCGCAGGAG. The relative mRNA values were normalized to the control values of the GAPDH gene and calculated using the comparative cycle threshold ( △△ Ct) method [30] .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!