Real-time PCR amplification and DNA melting with fluorescence measurements were performed on a Rotor-Gene Q HRM system (Qiagen, Hilden, Germany). The total volume of 20 µL reaction mixture contained 20 ng genomic DNA, 10 µL of MeltDoctor™ HRM Master Mix (Applied Biosystems, Foster City, CA, USA), 0.2 µL of 10 mM forward primers and reverse primers (Table 2 ). Conditions are as follows; 95 °C for 5 min followed by 35 cycles of 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 20 s. The temperature increased from 60 to 95 °C, at 0.1 °C/s.
Rotor gene q hrm system
Manufactured by Qiagen
Sourced in Germany
The Rotor-Gene Q HRM system is a real-time PCR cycler designed for high-resolution melt (HRM) analysis. It can perform both real-time PCR and HRM in a single run, allowing for gene scanning and genotyping applications.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using rotor gene q hrm system
1
Real-time PCR Amplification and Melting
2
Carnosine Transport Gene Expression in Heart
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of PHT1 and PHT2 genes (encoding carnosine transporting proteins) was assessed in left ventricles via real-time RT-PCR. Total RNA was isolated using Trizol® (Invitrogen) and chloroform and precipitated in isopropanol. RNA concentration and purity were measured in a micro-spectrophotometer (NanoDrop ND2000, Thermo Scientific), with integrity being confirmed in denaturing agarose gel. cDNA was synthesised with oligo DT and M-MLV reverse transcriptase (Promega). PCR was carried out with 20 ng cDNA, 22 μl SYBR™ Green (Applied Biosystems) and 300 nM of each primer in a final volume of 44 μl. The cycling conditions were: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60° for 60 s, and a final 65-95 °C melting ramp with 1 °C increments. Signal intensity was monitored using the Rotor Gene-Q HRM system (Qiagen). Relative gene expression was calculated using the 2−ΔΔCt method with the YWHAZ gene being used as the reference gene. Primers sequences were as follows: PHT1 5′-GAGGGCCGTTCACAGAGGA-3′ and 5′-TGAGGCCTTATAGTCTGCAG-3’; PHT2 5′- GAGTCTGGGTCACGGAGAC-3′ and 5′- GAGGCCCACGATGATGCTG-3’.
3
Quantifying CARNMT1 Expression in Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real‐time PCR was used to determine the expression of the CARNMT1 gene in human vastus lateralis having the EEF1A1 gene as a reference. Total RNA was isolated using Trizol® (Invitrogen) and chloroform and precipitated in isopropanol. RNA concentration and purity were measured in a micro‐spectrophotometer (NanoDrop ND2000, Thermo Scientific), with integrity being confirmed in denaturing agarose gel. cDNA was synthesized with oligo DT and M‐MLV reverse transcriptase (Promega). PCR was carried out with 20 ng cDNA, 22 μL SYBR™ Green (Applied Biosystems), and 300 nM of each primer in a final volume of 44 μL. The cycling conditions were 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 60 s, and a final 65–95°C melting ramp with 1°C increments. Signal intensity was monitored using the Rotor Gene‐Q HRM system (Qiagen). Primers sequences were as follows: CARNMT1: 5′‐TTCCGCTACTACGGCACC‐3′ and 5′‐TCCGGATCTTGTCCAAGTGA‐3; EEF1A1: 5′‐CTGGCAAGGTCACCAAGTCT‐3′ and 5′‐CCGTTCTTCCACCACTGAT‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!