Oligo dt 18 primers

Total RNA was extracted from 10–20 third-instar larvae or adult flies grown on the food indicated using Trizol^TM (Life Technologies, Carlsbad, CA, USA) [84 ]. Total RNA (1 µg) was DNase-treated using the DNA-free Kit (Ambion, Foster City, CA, USA) with inactivation buffer (DNA-free DNA Removal Kit, Invitrogen, Carlsbad, CA, USA). cDNAs were generated using oligo (dT) 18 primers (Eurofins, Luxembourg), dNTPs (ThermoFisher, Waltham, MA, USA), and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Fisher, Waltham, MA, USA). After amplification, the samples were treated with RNAse H (New England BioLabs, Ipswich, MA, USA). The cDNA was diluted in RNase/DNase-free water (ThermoFisher) (1:16), and qRT-PCR experiments were performed using ThermoScientific Absolute qPCR Mix, SYBR Green, ROX (Fisher) in an Applied Biosystems StepOnePlus System. Triplicate samples were used in all the experiments including linearizations and melt curves. All the experiments were performed at least three independent times (separate biological samples), as indicated in the figure legends. The results were normalized to the transcript levels of Drosophila melanogaster ribosomal protein L32 (RpL32). The following primers were used: MIOX exon 2-3 forward GACACCACCGATCCTCTAAAGG and reverse GGAAGGCGTGGATGATGT, RpL32 forward CCAGCATACAGGCCCAAGAT and reverse GCACTCTGTTGTCGATACCC.

Total RNA was extracted from 10–20 third instar larvae or adult flies grown on the food indicated using Trizol™ (Life Technologies) (Green and Sambrook, 2012 ). Total RNA (1 µg) was DNase treated using the DNA-free Kit (Ambion) and inactivation buffer (DNA-free DNA Removal Kit, Invitrogen). cDNAs were generated using oligo (dT) 18 primers (Eurofins), dNTPs (ThermoFisher Scientific), and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Fisher). After amplification the samples were treated with RNAse H (New England BioLabs). The cDNA was diluted in RNase/DNase free water (ThermoFisher Scientific) (1:16) and for qRT-PCR experiments using ThermoFisher Scientific Absolute qPCR Mix, SYBER Green, ROX (Fisher) in an Applied Biosystems StepOnePlus System. Triplicate samples were used in all the experiments including linearizations and melt curves. All the experiments were performed at least three independent times (separate biological samples) as indicated in the figure legends. The results were normalized to the transcript levels of ribosomal protein 32 (RpL32). The following primers were used: Inos exon 1-2 forward GAAAGTGCAGGTGGACGATG and reverse GTCAGCGTGGATCCGTTGT, RpL32 forward CCAGCATACAGGCCCAAGAT and reverse GCACTCTGTTGTCGATACCCT.