Genomic DNA (gDNA) was purified after clone cell culture amplification and kept under antibiotic selection, using the DNeasy Blood & Tissue Kit (Quiagen) following the manufacturer’s instructions. PCRs were set using 50 ng of gDNA using PCRBIO HS Taq Mix Red (PCR Biosystems) and 0.4 µM of primers to amplify the CDS locus or the integrated repair template containing the resistance marker gene (Neo). The oligonucleotides OL05 + OL6 were used to detect KAP4 presence or absence, respectively. Oligonucleotides OL05 + OL07 were used to confirm integration of the repair template containing the neomycin (Neo) resistance marker at KAP4 loci. The PCR program used was 5 min at 95 °C followed by 25 cycles of 30 s at 95 °C, 30 s at 55 °C, 20 s at 72 °C and a final elongation step of 5 min at 72 °C. Reactions were directly run in a 0.8% agarose gel in TBE to confirm genetic manipulation by comparing the presence or absence of WT and mutants PCR products. Primer sequences are detailed in Table 1 .
Pcrbio hs taq mix red
Manufactured by PCR Biosystems
Sourced in United Kingdom
PCRBIO HS Taq Mix Red is a ready-to-use, high-specificity PCR master mix containing a robust Taq DNA polymerase and all the necessary reagents for efficient PCR amplification. It is optimized for reliable and sensitive PCR performance across a wide range of templates and applications.
Automatically generated - may contain errors
Lab products found in correlation
Chromas lite 2, by Technelysium (2 mentions)
Gel dna fragments extraction kit, by Geneaid (2 mentions)
Bigdye terminator v3, by Thermo Fisher Scientific (2 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Ultrapure water, by Sartorius (1 mentions)
Ethidium bromide, by Avantor (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Ms 222, by Merck Group (1 mentions)
Pcrbio rapid extract lysis kit, by PCR Biosystems (1 mentions)
Xhoi, by New England Biolabs (1 mentions)
Qiamp dna micro kit, by Qiagen (1 mentions)
Abi 3730xl dna sequencer, by Macrogen (1 mentions)
Qiaamp dna stool mini kit, by Qiagen (1 mentions)
Invisorb fragment cleanup, by Stratec (1 mentions)
Primestar gxl dna polymerase, by Takara Bio (1 mentions)
Primestar gxl buffer, by Takara Bio (1 mentions)
Abi prism 3130, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v 3.1 chemistry, by Thermo Fisher Scientific (1 mentions)
Abi prism 3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
13 protocols using pcrbio hs taq mix red
1
Isolation and Characterization of Genomic DNA
2
PCR Validation of Genomic Insertions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for a subset of insert sites were designed in Primer3 software (See primer sequences in Table S3 http://bioinfo.ut.ee/primer3-0.4.0/ ) for PCR validation. Each PCR reaction was prepared with 10 μl of PCRBIO HS Taq Mix Red (PCRBiosystems), 7 μl of ultrapure water (Biological Industries), 1 μl of the site-specific primer (10 μM) and 1 μl of template genomic DNA (~ 50 ng/μl). The PCR conditions were 95°C incubation for 2 min, 40 cycles of 95°C for 10 s, the specific annealing temperature (calculated according to each primer set) for 15 s and 72°C for 15 s. PCR products were tested on 1.5% agarose gels and visualized with ethidium bromide (Amresco). Expected product sizes were determined by a DNA size standard (100 bp ladder, SMOBIO), and for some insertions the amplified products were extracted from gel and sequenced for validation.
3
Multiplex PCR Screening of pSEIL-3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A novel six-gene multiplex PCR scheme for the molecular screening of pSEIL-3 was developed. The primers were designed (Table 3 ) based on the sequences of six genes whose combination was unique according to the NCBI Nucleotide database search. The multiplex PCR was performed with PCRBIO HS Taq Mix Red (PCRBIO-systems, United Kingdom) at the following conditions: denaturation at 95°C for one minute, 29 cycles of denaturation (95°C, 15 s), annealing (61.1°C, 15 s) and elongation (72°C, 90 s).
4
CRISPR Gene Editing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue samples were taken from specimens sacrificed by overdose of 0.5% MS-222 (Sigma-Aldrich) to extract genomic DNA using PCRBIO Rapid Extract Lysis Kit (PCRBiosystems). Fragments of 190–420bp surrounding predicted deletion sites were amplified using PCRBIO HS Taq Mix Red (PCRBiosystems) with an annealing temperature of 56°C using following primer pairs: sox10 5’-CTGTCACCGGGTCATTCCTC-3’ and 5’-GCGTTCATTGGCCTCTTCAC-3’; sox10-like 5’-ATGGTCACTCACTGTCACCG-3’ and 5’-CCTCCTCGATGAATGGCCTC-3’. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) before Sanger sequencing. All protocols were conducted following manufacturer’s instructions. Sequence analysis to infer CRISPR edit sites was performed using the Synthego ICE CRISPR analysis tool (https://ice.synthego.com/ ).
5
Genotyping of Caudal Fin Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping was performed on a small clipping of the caudal fin from adults or on whole larvae. Samples were lysed with Proteinase K and targets of interest amplified by PCR5 using PCRBIO HS Taq Mix Red (PCR Biosystems) (Table S1 ). Genotypes were identified by agarose gel electrophoresis after enzymatic digestion of the bsx PCR fragment with XhoI (New England Biolabs) as previously described.5
6
DNA Extraction from Enucleated Eyes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was isolated from enucleated eyes 3 weeks following cell transplantation using the PicoPureTM DNA extraction Kit (Life Technologies). A PCR reaction was conducted using 2× PCRBIO HS Taq Mix Red (PCR Biosystems, London, UK) with 300 ng of DNA in a total volume of 20 μL. The reaction was performed as described in the kit instructions with annealing at 56 °C for 20 s.
7
Genomic DNA Extraction and Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from tissues using the Qiamp DNA Micro Kit (Qiagen, Inc.) following the manufacturer’s protocols. Partial sequences of two nuclear (18S rRNA, histone 3) and one mitochondrial (16S rRNA) markers were amplified and sequenced. Polymerase chain reactions (PCR) were performed in 20-μl volumes containing 1 μl of DNA template, 0.4 μM of each primer, distilled water, and 1x PCRBIO HS Taq Mix Red (PCR Biosystems, London, UK). The primers and details of PCR conditions are indicated in S1 Table . The amplified DNA was purified using a Gel/PCR DNA Fragments Extraction Kit (GENAID, Taiwan). Sanger sequencing reactions were performed using an ABI3730XL DNA Sequencer by Macrogen (Amsterdam, The Netherlands).
The chromatograms were visually checked and manually edited where appropriate using ChromasPro v2.1.9 software (Technelysium, Brisbane, Australia). Details of analysed taxa including isolation numbers and GenBank accession numbers are indicated inTable 1 . Classification and nomenclature follow Kočárek et al. [3 (link)]. Specimens published under the name Latinozoros barberi (Gurney, 1938) [30 ] without description or illustration of critical diagnostic characters (which would allow the assignment to one of the differentiated species) are presented as Latinozoros “barberi”.
The chromatograms were visually checked and manually edited where appropriate using ChromasPro v2.1.9 software (Technelysium, Brisbane, Australia). Details of analysed taxa including isolation numbers and GenBank accession numbers are indicated in
8
Molecular Detection of Zoonotic Parasites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Collected faecal samples were examined by otation with a saturated sugar solution of speci c gravity 1.3 and larvoscopy by Baermann. All samples were subsequently analysed by PCR for presence of tapeworm Echinococcus granulosus, E. multilocularis and Taenia crassiceps. Total genomic DNA was isolated from individual faecal samples using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and then stored at -20 °C. Single target PCRs were performed for ampli cation DNA fragments of the mitochondrial gene (nad1) of E. granulosus and the small subunit of ribosomal RNA (rrnS) of E. multiocularis and Taenia spp. [26] using PCRBIO HS Taq Mix Red (PCR Biosystems Ltd, London, United Kingdom). All PCRs were carried out in the total volume of 25 µl with 2 µl of extracted DNA. Amplicons were visualised on 1.2% agarose gel using Midori Green (Elisabeth Pharmacon, Brno, Czech Republic) under UV light. Positive samples were puri ed using the Invisorb Fragment CleanUp (Stratec Molecular GmbH, Berlin, Germany) directly from the amplicons. Sequencing was provided by private service company (SEQme s.r.o., Dobříš, Czech Republic) on an automatic ABI 3730 DNA analyzer and obtained sequences were identi ed by BLAST analysis.
9
Plant DNA Extraction and ITS Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plant DNA was extracted from 3–4 mg of dried ground root samples by adding 500 µl 0.5 M NaOH with 1.5% PVP to each sample, incubating it in room temperature for 10 min, and centrifuging for 2.5 min at 16,000 g. Then, 5 μl of the supernatant was added to 150 µl 100 mM TRIS, followed by vortexing and a spin down. We amplified the internal transcribed spacer (ITS) region of plant samples. Plant DNA was amplified using ITS2‐S2L (5′‐ATGCGATACTTGGTGTGAAT) and ITS2‐S3R (5′‐GACGCTTCTCCAGACTACAAT) Primers (Yao et al., 2010 (link)). For the PCR reaction, we used 15 µl PCRBIO HS Taq Mix Red (PCR Biosystems Ltd), 2 µl of DNA, 1.5 µl of each primer and 10 µl DDW. PCR reactions were performed as follows: initial 5 min at 95°C followed by 35 cycles of 30 s 95°C, 40 s 56°C, 1 min 72°C and final cycle with 10 min 72°C. Then, 10 µl of the PCR product was run on 1.5% agarose gel. PCR reaction samples with one clear band were purified by Exo1 and SAP enzymes. Then, the DNA samples were Sanger sequenced by the Biological Services Department, Weizmann Institute of Science, Rehovot, Israel.
10
PCR-based Sequence Validation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR validation was performed using primers designed with PRIMER3 version 4.1.0 based on identified sequence variations (see S2 Table for primer sequences), such as deleted or newly introduced sequences and sequences flanking deletions. To generate PCR products up to 800 bp, each reaction contained: 10μl PCRBIO HS Taq Mix Red (PCRBiosystems), 7 μl ultrapure water (Biological Industries), 1 μl of each site-specific primer (10μM) and 1 μl of template genomic DNA (approximately 50 ng/μl). The PCR conditions were 95°C for 2 min, 35 cycles of 95°C for 10 sec, the calculated annealing temperature for 15 sec and 72°C for 15 sec. For PCR products longer than 800 bp, each reaction contained 12 μl ultrapure water (Biological Industries), 4 μl of 5X PrimeSTAR GXL Buffer (TaKaRa), 1.6 μl of 2.5 mM dNTPs, 0.5 μl of each site-specific primer (10 μM) and 0.4 μl of PrimeSTAR GXL DNA Polymerase (1.25 U, TaKaRa). The PCR conditions used were 94°C for 5 min, 30 cycles of 98°C for 10sec, the calculated annealing temperature for 15 sec and 68°C for 1 min. PCR products were visualized in 0.8–1% agarose gels. Note that expected PCR products were extracted from the agarose gel, and sequenced for validation. Figures were prepared using GIMP (https://www.gimp.org/ ), and Microsoft PowePoint.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!