Ultrasonic breaker

Cells were harvested by centrifugation at 8228 g for 5 min followed by sonication via ultrasonic breaker (Scientz, China). The lysate was centrifuged at 4 °C and 18,514g for 30 min in a refrigerated centrifuge. After filtering through a 0.22 μm filter membrane, the supernatant of the lysate was loaded onto a HisTrap HP affinity column equilibrated with loading buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole; pH 7.5). Pure target protein was obtained by eluting with elution buffer (20 mM Tris-HCl, 150 mM NaCl, 1 M imidazole; pH 7.5) at 2–3 mL·min⁻¹. Desalination was conducted with low-salt buffer (10 mM Tris-HCl, 0.1 M NaCl; pH 7.5) using a disposable PD-10 desalting column. Characterization was performed using 10% (w/v) sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) with the addition of 20% (v/v) β-mercaptoethanol, followed by the accurate determination of protein mass using Q-TOF MS (Waters, USA) with ultra-pure water as the solvent.

ChIP assay was performed as described previously.¹¹ (link) ChIP was carried out by the ChIP Assay Kit (Millipore, USA). In brief, 10⁷ AC16 cells were cross-linked with 37% formaldehyde and 1.5 M glycine. Nuclei were obtained after lysis and centrifugation. The nuclear components were extracted with nuclei lysis buffer and then obtained the DNA fragment by ultrasonic breaker (Scientz, China). The supernatant was collected, and the total volume was recorded. Then the supernatant was incubated with IgG antibody (Sigma, #SAB3700848), H3K27me3 antibody (Cell Signaling Technology, # 9733) or EZH2 antibody (abcam, # ab3748) at 4°C overnight separately. 1% supernatant was taken as input and stored at 4 °C. Then pre-cleaning G-sepharose were added into the mixture and incubated at 4 °C for 90 min. After centrifugation, the supernatant was removed and beads were washed repeatedly. IP elution buffer was added to the beads and the process of de-crosslinking was performed by heating at 65 °C overnight. Finally, DNA were extracted for qRT-PCR analysis. The primer sequences were as follows: Forward primer, 5ʼ- AGCAGGCATCCATGAAATGT-3ʼ, Reverse primer, 5ʼ- AAGTGGTTCACCAAGTGCAA -3ʼ.