Faststart universal sybr premix extaq

Total RNA was extracted from the cultured cells and tissues using TRIzol Reagent (Invitrogen, Carlsbad, USA) and reverse transcribed into cDNA with a Revert Aid First Strand cDNA Synthesis kit (Fermentas, Burlington, Canada). RT-qPCR was performed using FastStart Universal SYBR Premix ExTaq (Takara Biotechnology, Japan) and analyzed on an ABI VII7 Real-Time RT-PCR system (Bio-Rad Laboratories Inc., Hercules, CA, USA). The sequences of primers used for RT-qPCR are listed in Supplementary Table 1. The fold changes of target mRNA expression relative to GAPDH were calculated based on the threshold cycle (C_T) as r = 2^−Δ(ΔC_T), where ΔC_T = C_T (target) − C_T (GAPDH) and Δ (ΔC_T) = ΔC_T (experimental) − ΔC_T (control).

For analysis of Akk level by qRT‐PCR, fecal samples were freshly collected and weighed. Fecal genomic DNA was extracted from fecal samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and subjected to qRT‐PCR amplification with the specific primers designed from the variable regions of the 16S rRNA gene sequence of Akk (forward, 5′‐CCTTGCGGTTGGCTTCAGAT‐3′, and reverse, 5′‐CAGCACGTGAAG GTGGGGAC‐3′) as described previously.^[48] The amplification reactions were carried out in 10 µL reaction volumes containing primers and FastStart Universal SYBR Premix ExTaq (Takara Biotechnology, Japan), and were performed in FTC‐3000 real‐time PCR system (Funglyn Biotech Inc., Toronto, Canada). The cycle threshold of each sample was compared with a standard curve (performed in duplicate) made by diluting genomic DNA from Akk. The data were expressed as log₁₀ of Akk number per gram of fecal content.
For analysis of the expression of osteogenesis‐ or osteoclastogenesis‐related genes, total cellular RNA of BMSCs and RAW264.7 cells in different treatment groups was isolated using TRIzol Reagent (Invitrogen) and reverse‐transcribed into cDNA with All‐in‐One cDNA Synthesis SuperMix (Biotool, Houston, USA), followed by qRT‐PCR using FTC‐3000 real‐time PCR system. Gapdh served as an internal control. Primers for qRT‐PCR are shown in Table S5 in the Supporting Information.