RNA was prepared from cells using TRIzol reagent and cDNAs were synthesized using SuperScript II reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). RT-qPCR was performed on an ABI-Prism 7700 Sequence Detection system, with use of the fluorescent dye SYBR-Green Master Mix (Applied Biosystems, Thermo Fisher Scientific, Inc., Beijing, China) as described by the manufacturer. The results were normalized against that of the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same sample. The primers used were as follows: Human PAX6, 5′-AGACACAGCCCTCACAAAC-3′ (forward) and 5′-ATCATAACTCCGCCCATTC-3′ (reverse); human GAPDH, 5′-GACTCATGACCACAGTCCATGC-3′ (forward) and 5′-AGAGGCAGGGATGATGTTCTG-3′ (reverse). The PCR reaction mixture contained 12.5 µl SYBR-Green Master Mix (Thermo Fisher Scientific, Inc.), 500 ng template cDNA, forward and reverse primers (0.25 µM each) and 12 µl nuclease-free water (Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 20 sec at 95°C; followed by 40 cycles of 5 sec at 95°C and 30 sec at 60°C. Each experiment was repeated three times in duplicate.
Sybr green master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Canada, Switzerland, China, Japan, Lithuania, Belgium, France, Netherlands, Singapore, Sweden, Finland, Italy, Spain, Denmark, India, Austria, New Zealand
SYBR Green Master Mix is a ready-to-use solution designed for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, DNA polymerase, dNTPs, and buffer components. The SYBR Green dye binds to double-stranded DNA, allowing the detection and quantification of target DNA sequences during the PCR amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (1153 mentions)
Trizol, by Thermo Fisher Scientific (556 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (466 mentions)
Rneasy mini kit, by Qiagen (459 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (262 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (189 mentions)
Rneasy kit, by Qiagen (149 mentions)
Iscript cdna synthesis kit, by Bio-Rad (133 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (127 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (111 mentions)
Nanodrop, by Thermo Fisher Scientific (100 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (89 mentions)
Superscript 3, by Thermo Fisher Scientific (87 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (86 mentions)
Primescript rt reagent kit, by Takara Bio (84 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (83 mentions)
Tri reagent, by Merck Group (78 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (76 mentions)
Dnase 1, by Thermo Fisher Scientific (75 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (74 mentions)
3 738 protocols using sybr green master mix
1
Quantifying PAX6 Expression in Cells
2
Quantitative PCR with SYBR Green
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Commercially available Sybr green master mix (applied biosystems Sybr green master mix, Life technologies 5791 van allen way carlsbad clifornia 92008 United States of America) 5 μl was added along with 0.5 μl of forward primer and reverse primer each, 2.0 μl of template DNA and 2.0 μl of sterile water. 10 μl of the prepared mix was dropped in micro wells and subjected to PCR analysis, while amplification was done using values obtained from cycle threshold (Ct) equation.
3
Quantitative Analysis of TGF-beta Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each sample was tested in triplicate and all quantifications were normalized to an endogenous control (GAPDH). Total RNA was isolated using Total RNA Purification Kit (CellCo Biotec). We performed cDNA synthesis using the High Capacity Reverse Transcription Kit, (Applied Biosystems). The qPCR amplification was performed and analyzed with ABI Prism 7500 sequence detector (Applied Biosystems). The qPCR reactions were performed using SYBR Green Master Mix (Applied Biosystems) , with 5 µl of template cDNA, 8 pmol of primers, and 10 µl of SYBR Green Master Mix. The primers used for PCR amplification were: for GAPDH gene: F-AGGTCGGTGTGAACGGATTTG, R-TGTAGACCATGTAGTTGAGGTCA; TGF-beta: F-CTCCCGTGGCTTCTAGTGC, R-GCCTTAGTTTGGACAGGATCTG.
4
Quantifying mtDNA and nDNA Levels by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both the mtDNA and nDNA content were measured by qRT-PCR using SYBR Green Master Mix (Applied Biosystems, CA, USA) followed by evaluation of the average CT values from triplicate reactions from Real Time PCR software. Primers were designed and used for relative quantification for mtDNA to nDNA content. Two primer pairs were used for the amplification of two mitochondrial genes: MT-ND1 and mtDNA 16S. Two primer sets were used for the amplification of the single-copy nuclear gene human globulin (HGB) and 36B4. Primers used are listed in Supplementary Table 2 .
Briefly, 10 μL of qRT-PCR reaction for each gene consists of 1 X SYBR Green Master Mix (Applied Biosystems, CA, USA), 200 nmol/L each primer, and 1 μL of purified serum DNA sample diluted 1:6. To determine the mtDNA content relative to nDNA, the following equations were used as previously described [19 (link), 20 (link)].
ΔCT = (nDNA CT – mtDNA CT).
Relative mitochondrial DNA content = 2 × 2ΔCT
Briefly, 10 μL of qRT-PCR reaction for each gene consists of 1 X SYBR Green Master Mix (Applied Biosystems, CA, USA), 200 nmol/L each primer, and 1 μL of purified serum DNA sample diluted 1:6. To determine the mtDNA content relative to nDNA, the following equations were used as previously described [19 (link), 20 (link)].
ΔCT = (nDNA CT – mtDNA CT).
Relative mitochondrial DNA content = 2 × 2ΔCT
5
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNEasy Mini Kit (Qiagen) and reverse transcribed using the VersoTM cDNA Synthesis Kit (Thermo Fisher) or First Strand Synthesis Kit (Invitrogen). qRT-PCR was performed in triplicate for each gene (Table S1), using ABsoluteTM Blue QPCR Sybr Green Master Mix (Thermo Fisher) or Sybr Green Master Mix (Applied Biosystems) and 7300 Real-Time PCR System (Applied Biosystems) or CFX96 PCR Cycler (Biorad). Gene-specific qRT-PCR standards were used to determine transcript levels and normalized to β-actin expression [12 (link)]. PCRs were set up in triplicate and performed at least 3 times.
For the validation of mRNA sequencing data, qPCR was done using Sybr Green Master Mix (Applied Biosystems) and primers specific to genes of interest (Table S2). The mean cycle threshold (Ct) values from the triplicate run for each sample were analyzed using β-actin as the reference gene. ΔΔCt method [22 (link)] was used to calculate the relative expression using the following steps: (1) Normalization to reference gene: ΔCtGOI = CtGOI – CtBA. (2) Relative expression between conditions: ΔΔCtGOI = ΔCtEXP – ΔCtCNT. The analysis was done using Microsoft Excel and Prism.
For the validation of mRNA sequencing data, qPCR was done using Sybr Green Master Mix (Applied Biosystems) and primers specific to genes of interest (Table S2). The mean cycle threshold (Ct) values from the triplicate run for each sample were analyzed using β-actin as the reference gene. ΔΔCt method [22 (link)] was used to calculate the relative expression using the following steps: (1) Normalization to reference gene: ΔCtGOI = CtGOI – CtBA. (2) Relative expression between conditions: ΔΔCtGOI = ΔCtEXP – ΔCtCNT. The analysis was done using Microsoft Excel and Prism.
6
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was determined using quantitative real-time PCR (qRT-PCR). Tissue samples for RNA isolation were homogenized in RLT buffer using the MagNA Lyser Instrument (Roche). Total RNA was isolated using the RNeasy Fibrous Tissue Mini Kit (Qiagen) with a Proteinase K step according to the manufacturer's protocol. The RNA concentration was determined using a Nanodrop spectrophotometer and subsequently reverse transcribed into cDNA. qRT-PCR was performed using specific primers and the SYBR Green Master Mix in the Applied Biosystems StepOnePlus real-time PCR system (Applied Biosystems). qRT-PCR reactions were performed in a total volume of 10 mL, containing 3 mL cDNA, 1 mL forward primer (2 mM), 1 mL reverse primer (2 mM) and 5 mL SYBR Green Master Mix (Applied Biosystems). Reactions were presented as minus delta threshold cycle Ct (-DCt) values, calculated by correcting the negative threshold cycle (-Ct) of the gene of interest to the -Ct of the reference gene GAPDH. qRT-PCR analysis was performed on a minimum of six mice per group.
7
Quantitative RT-PCR Analysis of Follistatin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells and liver tissues was isolated using TRIzol reagent (Thermo Fisher, USA). cDNA was prepared from 1000 ng RNA samples using a TAKARA reverse transcription (RT) kit (#RR037A, Japan). Then, qPCR was performed using SYBR Green Master Mix (#A25780, Thermo Fisher, USA) and specific qPCR primers sets (Table 1 ) in a Real-Time PCR system (Applied Biosystems, USA). The results were calculated based on Ct values and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
The Primer Sequences Used in This Study
| Species | Name | Sequence (5’-3’) |
|---|---|---|
| Human | GAPDH-QF | CCACTCCTCCACCTTTGAC |
| Human | GAPDH-QR | ACCCTGTTGCTGTAGCCA |
| Human | FST-F | CCAGCGAGTGTGCCATGAAG |
| Human | FST-R | TCATCTTCCTCCTCTTCCTCG |
| Mouse | Gapdh-QF | GGGTCCCAGCTTAGGTTCATC |
| Mouse | Gapdh-QR | CCAATACGGCCAAATCCGTTC |
| Mouse | fst-F | GATTGTTTACGCCAGCGCAT |
| Mouse | fst-R | TCGCATGACTTGGCCTTGAT |
8
Quantification of RASAL2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated according to the protocol of TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription (RT) to synthesize complementary DNA (cDNA) was performed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). The aliquots of cDNA were amplified using SYBR Green Master Mix (Thermo Fisher Scientific). β-actin was used as endogenous control. The RASAL2 and β-actin primers (Additional file 1 : Table S2) were designed using Primer3web [20 (link), 21 (link)].
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription and qPCR have been described previously64 (link). Primer sequences are listed in Supplementary Table S3 . Gene expression data were normalized with delta CT method against the geo-mean of internal control genes HPRT and β-actin. qPCR assays were run with at least 2 technical replicates for each sample with no template and no reverse transcriptase controls in StepOnePlus real time PCR system using fast SYBR green master mix (ThermoFisher Scientific).
10
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using the RNeasy Mini Kit (Qiagen, #74106). RNA concentration was measured using the Qubit RNA Broad Range Assay Kit (ThermoFisher, #Q10211 ). cDNA synthesis was performed using SuperScript VILO Master Mix (ThermoFisher, #11755-250) with 600 ng total RNA as input. Quantitative reverse transcription (qRT)–PCR was performed using SYBR Green Master Mix (ThermoFisher, #4367659) on a QuantStudio6 Flex Real-Time PCR System (ThermoFisher). Relative expression was determined using the ∆∆CT method and Rpl32 as normalization control. The following primers were used:
DptA-forward: CCACGAGATTGGACTGAATG
DptA-reverse: GGTGTAGGTGCTTCCCACTT
S6K-forward: ACTGGGCGCTCTCATGTTTG
S6K-reverse: TTGGCTTTCAGAATGGTCT
Rpl32-forward: ATATGCTAAGCTGTCGCACAAATGG
Rpl32-reverse: GATCCGTAACCGATGTTGGGCA
DptA-forward: CCACGAGATTGGACTGAATG
DptA-reverse: GGTGTAGGTGCTTCCCACTT
S6K-forward: ACTGGGCGCTCTCATGTTTG
S6K-reverse: TTGGCTTTCAGAATGGTCT
Rpl32-forward: ATATGCTAAGCTGTCGCACAAATGG
Rpl32-reverse: GATCCGTAACCGATGTTGGGCA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!