Empty vector

We induced overexpression and knockdown expression of KISS-1 mRNA in cells of the osteosarcoma cell line MG-63 in vitro, and used the same type of cells as control by transfecting them with empty vector (GenePharma, Shanghai, China). The cDNA of KISS-1 from the osteosarcoma cells was amplified by RT-PCR, and the pcDNA3.1-vector (GenePharma) was used to make constructs for eukaryotic expression using standard molecular cloning techniques. Tranfections of the MG-63 cells with KISS-1 expression vector were done using Lipofectamine (both from GenePharma), and screened by G418 (1 mg/ml). MG-63 cells with stable high expression of KISS-1 were subcultured. Additionally, a number of small interfering RNAs (siRNAs) were designed to knock down the KISS-1 expression in the MG-63 cells. The most effective siRNA segment giving the best silencing of KISS-1 expression was used in a eukaryotic expression vector pSUPER-KISS-1-siRNA, and transfected using Lipofectamine (both from GenePharma) into the cells (screened by G418 at 1 mg/ml). The MG-63 cells with stable low expression of KISS-1 were subcultured and used in subsequent experiments. The control cell line was made by transfecting the empty pcDNA3.1-vector into MG-63 cells. KISS-1 expression was verified by RT-PCR method in all the resulting cell lines.

lentiviral vectors expressing GFP were purchased from Genechem (Shanghai, China). The full-length human DDR1 coding sequences were obtained by PCR amplification and then accurately cloned to the lentiviral vector (Genechem, Shanghai, China). Using Lipofectamine 2000 (Invitrogen), the recombinant lentiviral vector was transfected into HEK293 T cells (Lentivirus-DDR1) for 48 h, followed by infection with RT4 cells. The stably transfected RT4 cells were screened using culture medium containing 6 μg/mL puromycin (Sigma, USA). RT4 cells transfected with the empty vector (GenePharma, Shanghai, China) were designed as a negative control (RT4-NC). The GFP density imparted by the lentiviruses was utilized to detect transfection efficiency. In addition, COL4A1-specific siRNA and the control siRNA were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and transfected into cells using Lipofectamine 2000 (Invitrogen) to inhibit COL4A1 in cells.

BMSCs were transfected with a multiplicity of infection (MOI) of 25, 50, 100, and 200 respectively, and 200 was found to be the best MOI. BMSCs in good condition were selected and inoculated on 24-well plates at a density of 1x10⁴ cells/well and incubated overnight at 37˚C. After 24 h, recombinant LV-small interfering (si)RNA-Wnt3a-mus (forward: AGTGCCTCGGAGATGGTGGTAG; reverse: GGGTTAGGTTCGCAGAAGTTGGG) lentivirus (GenePharma Co., Ltd.) or empty vector (GenePharma Co., Ltd.) lentivirus was added to the medium at a multiplicity of infection of 200 (MOI=200). The normal group was cultured with complete medium without adding lentivirus. After 96 h of infection, green fluorescent protein (GFP) was observed at x400 under an inverted fluorescence microscope (Olympus Corporation). Two groups were used: IGF-1 + EV (empty vector) and IGF-1 + siRNA-Wnt3a.