Nhs fluorescein

Manufactured by Thermo Fisher Scientific

Sourced in United States

NHS-fluorescein is a water-soluble, fluorescent labeling reagent. It can be used to covalently attach fluorescein to primary amine groups on proteins and other biomolecules.

Automatically generated - may contain errors

Lab products found in correlation

61 protocols using nhs fluorescein

Fluorescent Labeling of Protein Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

For fluorescent visualization, SI (control ELP) and crySI were covalently modified with NHS-Fluorescein (Thermo Fisher Scientific Inc., Rockford, IL) by conjugation to free amines. Briefly, crySI was mixed with a 3-fold molar excess of NHS-Fluorescein in phosphate buffered saline (PBS) and incubated at 4 °C for 3 h. Free fluorophore was removed by size exclusion chromatography using a Zeba desalt spin column (89891, Thermo Fisher Scientific Inc., Rockford, IL). The concentration of label after the purification, C_FL-crySI, was estimated as follows:

C_{F L - c r y S I} = \frac{A_{493}_{n m}}{ε_{f l u o r}}

where the molar extinction coefficient of fluorescein, E_fluor, was assumed to be 70,000 M⁻¹ cm⁻¹. Due to the low molar extinction coefficient of the crySI relative to the contribution of fluorescein at an optical absorbance of 280 nm, the degree of labeling, N_labeling, was estimated as follows:

N_{l a b e l i n g} = \frac{n_{F L - c r y S I, p u r i f i e d}}{n_{c r y S I, r e a c t e d}}

where n_{crySI,reacted} and n_{FL-crySI,purifled} are the moles of crySI reacted and fluorescein recovered after purification respectively. Fluorescein labeled FL-crySI had a labeling efficiency ~0.6. To determine the purity of labeled materials, proteins were separated on SDS-PAGE gels and imaged on a ChemiDoc Touch Imaging System (Bio-Rad Laboratories, Hercules, CA).

Sreekumar P.G., Li Z., Wang W., Spee C., Hinton D.R., Kannan R, & MacKay J.A. (2018). Intra-vitreal αB crystallin fused to elastin-like polypeptide provides neuroprotection in a mouse model of age-related macular degeneration. Journal of controlled release : official journal of the Controlled Release Society, 283, 94-104.

+ Open protocol

+ Expand

Stability Evaluation of ADC-Exendin-4 Conjugates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exendin-4 (GenScript, NJ, USA) at a concentration of 3 mg mL⁻¹ was labeled with 1 mM N-hydroxysuccinimide (NHS)–fluorescein (Thermo Fisher Scientific, MA, USA) on ice for 2 hours in PBS buffer (pH 7.4). Then, the reaction mixture was passed through Zeba spin desalting columns (Thermo Fisher Scientific, MA) with molecular weight cut-off at 7 kDa for removing free NHS-fluorescein.
Acquired fluorescein-labeled exendin-4 (0.75 mg mL⁻¹) and Alexa Fluor 488-conjugated surrogate DAR2-ARC-ADC (3 μM) and DAR4-ARC-ADC (3 μM) were incubated in fresh CD-1 mouse plasma containing 100 μg mL⁻¹ of penicillin-streptomycin (Thermo Fisher Scientific, MA) in a 37°C incubator with 5% CO₂ for 14 days. During the incubation, 1 μL of mixture was periodically extracted and frozen at −20°C until the final SDS-PAGE gel analysis. Prior to Coomassie staining, SDS-PAGE gels were imaged by a ChemiDoc Touch Imager (Bio-Rad, CA, USA) for the presence of intact conjugated surrogate ADCs or fluorescein-labeled exendin-4 under the fluorescence mode. The intensity of fluorescent bands on SDS-PAGE gels were quantified by Image Lab (Bio-Rad, CA, USA).

Dai Z., Zhang X.N., Cheng Q., Fei F., Hou T., Li J., Abdolvahabi A., Watanabe J., Pei H., Smbatyan G., Xie J., Lenz H.J., Louie S.G, & Zhang Y. (2021). Site-Specific Antibody-Drug Conjugates with Variable Drug-to-Antibody-Ratios for Acute Myeloid Leukemia Therapy. Journal of controlled release : official journal of the Controlled Release Society, 336, 433-442.

+ Open protocol

+ Expand

Fluorescent Labeling of Collagen and Fibronectin

Check if the same lab product or an alternative is used in the 5 most similar protocols

For matrix assembly studies, fluorescently labeled collagen (10 μg/mL) or Fibronectin (6 μg/mL) was added to cells plated 24 hr after plating. Cells were cultured in growth medium in the absence of ascorbic acid. After 24 hr culture with the fluorescently labeled protein, cells were fixed and stained as described above.
To fluorescently label collagen, 1 mg rat tail type I collagen (1 mg/mL in PBS; Corning) was incubated for 2 hours on ice, rocking, with 12.5 μL of 1M sodium bicarbonate buffer, pH 9, and 12.5 μL of 1 mg/mL NHS-Fluorescein (Fisher Scientific) in DMSO. The collagen was then placed in 8 kDa MWCO dialysis tubing and left in 0.1% acetic acid in PBS for 4 hours at 4°C, stirring, to remove unconjugated NHS-Fluorescein. The labeled collagen was stored at 4°C.
Fibronectin was labeled with NHS-Fluorescein according to previously a published protocol [23 (link)], with some minor modifications. Briefly, 10 mg of bovine Fibronectin (Millipore-Sigma) was suspended at 1 mg/mL in PBS. Fibronectin was dialyzed in PBS overnight using 8 kDa dialysis tubing, then incubated with 125 μL of 1M sodium bicarbonate buffer, pH 9, and 125 μL of 1 mg/mL NHS-Fluorescein (Fisher Scientific) in DMSO for 2 hours at room temperature, rocking. Labeled Fibronectin was separated using PD-10 desalting columns (GE Life Sciences) and stored at -70°C.

Jones C.E., Sharick J.T., Colbert S.E., Shukla V.C., Zent J.M., Ostrowski M.C., Ghadiali S.N., Sizemore S.T, & Leight J.L. (2021). Pten regulates collagen fibrillogenesis by fibroblasts through SPARC. PLoS ONE, 16(2), e0245653.

+ Open protocol

+ Expand

Fluorescent Estrogen Conjugate Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The estrogen derivative

E sub 2 003

(

0.36 grams

) was conjugated to 5-carboxyfluorescein succinimidyl ester (NHS-Fluorescein, CAT number C2210, Invitrogen,

0.61 grams

) in DMSO for 16 h at rt in the dark. Then, the solution was diluted with

H sub 2 O

(

10 milliliters

) and extracted with EtOAc (

20 milliliters

) three times. The organic phases from the three extraction processes were combined, dried, concentrated, and then purified by preparative high-performance liquid chromatography (HPLC). The purification was performed using a Hewlett-Packard 1100 series HPLC instrument (Hewlett-Packard) equipped with a Gilson pumping system (Gilson), a Gilson 215 autosampler (Gilson), a Gemini C18 column (Phenomenex), and a photodiode array detector (Hewlett-Packard). The mobile phase [

H sub 2 O virgule acetonitrile open parenthesis CH sub 3 CN close parenthesis

] was set to a linear gradient from 90/10 to 10/90 at a flow rate of

25 milliliters per minute

, and the elution composition was detected at

254 nanometers

. After purification, a yellow solid product,

E sub 2 F

(

0.15 grams

), was obtained. Stock solutions of

E sub 2 F

(

1 millimolar

) were prepared in DMSO and were stored at

negative 80 degree Celsius

until use.

Cao L.Y., Ren X.M., Yang Y., Wan B., Guo L.H., Chen D, & Fan Y. (2018). Hydroxylated Polybrominated Biphenyl Ethers Exert Estrogenic Effects via Non-Genomic G Protein–Coupled Estrogen Receptor Mediated Pathways. Environmental Health Perspectives, 126(5), 057005.

+ Open protocol

+ Expand

Recombinant AdV5 Virus Labeling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

E1- and E3-deleted recombinant AdV5 expressing GFP or mycobacterial antigen 85A (Ag85A) was generated by the Jenner Institute Viral Vector Core Facility, University of Oxford, UK, as described previously (Cubillos-Zapata et al., 2011 (link)).
For some assays, aliquots of 1×10¹¹ virus particles of AdV5 were labelled with NHS-AlexaFluor568, NHS-biotin or NHS-fluorescein (Invitrogen) following the manufacturer’s instructions and labelled virus was dialysed twice against PBS. The virus was then titrated in 293 cells and GFP expression was measured by flow cytometry. In some cases, the titre was found to be 1 log lower after labelling and the infectious doses were adjusted as required.

Guzman E., Taylor G., Hope J., Herbert R., Cubillos-Zapata C, & Charleston B. (2016). Transduction of skin-migrating dendritic cells by human adenovirus 5 occurs via an actin-dependent phagocytic pathway. The Journal of General Virology, 97(10), 2703-2718.

+ Open protocol

+ Expand

Antibody Panel for Cellular Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary antibodies for Phospho-S6 Ribosomal Protein ser235/236, mTOR, phospho-4EBP1, and GAPDH were from Cell Signaling, Phospho-FAK (Tyr397), HPDL from Thermo Fisher, Paxilin and LAMP2 from BD-bioscience; PAK1 from Proteintech. Secondary antibodies Alexa-fluor 594 anti-Rabbit IgG, Alexa-fluor 488 anti-Rabbit IgG, Alexa-fluor 594 anti-Mouse IgG and Alexa-fluor 488 anti-Mouse IgG were from Cell Signaling, IRDye 800CW and IRDye 680CW were from LI-COR. Alexa fluor TM 555 Phalloidin, Click-iT EdU Imaging Kits, CellEvent Caspase-3/7 Green Detection kit, NHS-Fluorescein, NHS-Alexa Fluor 555, pH-rodo iFL STP ester red and Hoechst 33342 were from Invitrogen. DRAQ5 was from LI-COR. Collagen I and Matrigel were from Corning. Geltrex was from Thermo Fisher. All media and dialyzed FBS were from Gibco, except for DMEM with no amino acid which was from US Biological life science and Plasmax which was kindly provided by Dr Tardito, CRUK Scotland Institute, Glasgow. The details of Plasmax composition were previously described by Vande Voorde and colleagues [18 (link)]. E64d (Aloxistatin) and PF573228 were from AdooQ Bioscience. GM6001 was from APEXBIO. Dynasore, Filipin, and EIPA were from Sigma. FRAX 597 was from bio-Techne. Nitisinone was from MCE. PP2 was from Generon. C13-tyrosine was from Sigma-Aldrich.

Nazemi M., Yanes B., Martinez M.L., Walker H.J., Pham K., Collins M.O., Bard F, & Rainero E. (2024). The extracellular matrix supports breast cancer cell growth under amino acid starvation by promoting tyrosine catabolism. PLOS Biology, 22(1), e3002406.

+ Open protocol

+ Expand

Engineered Elastin-Like Protein Scaffold

Check if the same lab product or an alternative is used in the 5 most similar protocols

The presence of ELRs functionalized onto the Ti scaffolds was inspected by fluorescence visualization. To this end, the HRGD was fluorescently labeled with FITC in a molar ratio of 3:1 FITC to ELR and using an amine-reactive derivative of fluorescein dye (NHS-Fluorescein, Thermo Fisher Scientific, Waltham, MA, USA). Briefly, HRGD and FITC were dissolved in a DMF-DMSO mixture (1:1 v/v) at room temperature for 6 h. The FITC solution was slowly poured into the ELR solution and incubated for 24 h. Afterward, the reaction was precipitated in diethyl ether (Honeywell, Wabash, IN, USA), washed twice with acetone (Scharlab, Sentmenat, Spain), and allowed to dry under a vacuum at room temperature. The ELRs were dissolved in water at 4 °C and dialyzed against ultrapure water, sterilized by filtration, and freeze-dried. After functionalization, the scaffolds were immersed in liquid nitrogen and longitudinally crushed. The distribution of fluorescently labeled HRGD was assessed by visualization of the scaffolds using an MVX10 Research Macro Zoom Microscope (Olympus, Tokyo, Japan).

Guillem-Marti J., Vidal E., Girotti A., Heras-Parets A., Torres D., Arias F.J., Ginebra M.P., Rodriguez-Cabello J.C, & Manero J.M. (2023). Functionalization of 3D-Printed Titanium Scaffolds with Elastin-like Recombinamers to Improve Cell Colonization and Osteoinduction. Pharmaceutics, 15(3), 872.

+ Open protocol

+ Expand

Fluorescent Lectin Labeling and Cell Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lectins (EY Laboratories) were labeled with NHS-fluorescein (5/6-carboxyfluorescein succinimidyl ester) per the manufacturer’s instructions (Thermo Fisher Scientific). Residual NHS molecules were quenched by adding 10 mM Tris-HCl (pH 7) to the labeling reaction. The reaction buffer was exchanged for HBSS⁺ (Hanks buffered salt solution plus 1 mM CaCl₂ and 1 mM MgCl₂) five times using 10-kDa Amicon Ultra 0.5-ml centrifugal filters (Merck). Protein concentration and labeling efficiency were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). tCX and tUEC monolayers were dissociated with TrypLE (Gibco) and harvested into HBSS. Cells were washed twice in HBSS⁺ containing 0.1% (vol/vol) bovine serum albumin (BSA). Approximately 500,000 cells were resuspended in 1 ml of HBSS⁺ containing 100 μg/ml of labeled lectin. Cells were incubated for 15 min at 37°C and washed three times in HBSS⁺. Lectin-bound tCX and tUEC were detected using a CyAn ADP flow cytometer (Beckman Coulter). Data analysis was performed using FlowJo (Tree Star). Unlabeled cells, or cells treated with the buffer from the final elution step, were used as negative controls.

Semchenko E.A., Everest-Dass A.V., Jen F.E., Mubaiwa T.D., Day C.J, & Seib K.L. (2019). Glycointeractome of Neisseria gonorrhoeae: Identification of Host Glycans Targeted by the Gonococcus To Facilitate Adherence to Cervical and Urethral Epithelial Cells. mBio, 10(4), e01339-19.

+ Open protocol

+ Expand

Fluorescent Labeling Polypeptide MMP Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

iTEP-sMMP-pOVA was labelled with NHS-fluorescein (Thermo Fisher Scientific) using the manufacturer’s protocol. 10 μg labelled polypeptide was incubated with 10 μL concentrated (30×) cell culture supernatant or 100 ng recombinant mouse MMP-9 standard at 37 °C for overnight. For inhibition assay, the cell culture supernatant was treated with 30 mM 1,10-Phenanthroline (Sigma-Aldrich) for 2 h before the labelled polypeptide was added for overnight incubation. After incubation, the mixture was loaded to run SDS polyacrylamide gel electrophoresis (SDS-PAGE). The fluorescent image of the gel was captured using FluorChem FC2 imaging system (Alpha Innotech). The image was further analyzed by ImageJ [61 (link)].

Wang P., Dong S., Zhao P., He X, & Chen M. (2018). Direct loading of CTL epitopes onto MHC class I complexes on dendritic cell surface in vivo. Biomaterials, 182, 92-103.

+ Open protocol

+ Expand

ICAM-1 Binding Peptide Expression and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

bEnd.3 cells (ATCC CRL-2299) were from ATCC (Manassas, VA). SHuffle T7 Competent E. coli was from New England BioLabs Inc. (Ipswich, MA). DNA oligos encoding ICAM-1 Binding Peptide with BseRI sticky ends (/5Phos/GATTACCGACGGCGAAGCGACCGATAGCGGCGG, /5Phos/GCCGCTATCGGTCGCTTCGCCGTCGGTAATCCC) was synthesized by Integrated DNA Technologies (Coralville, IA). The plasmid expressing mICAM-1 turboGFP was from Origene (Rockville, MD). Rapamycin was from LC Laboratories (Woburn, MA, U.S.A.). NHS-Fluorescein, NHS-Rhodamine, and Zeba™ Spin Desalting Columns, 7K MWCO (10 mL), and LysoTracker™ Green DND-26 were from ThermoFisher Scientific Inc. (Rockford, IL). Sulfo-Cyanine 7.5 NHS ester was from Lumiprobe Corp (Hallandale Beach, FL). Goat antimouse ICAM-1 polyclonal antibody was from R&D Systems (Minneapolis, MN). Other reagents were from standard suppliers.

Ju Y., Guo H., Yarber F., Edman M.C., Peddi S., Janga S.R., MacKay J.A, & Hamm-Alvarez S.F. (2019). Molecular Targeting of Immunosuppressants Using a Bifunctional Elastin-Like Polypeptide. Bioconjugate chemistry, 30(9), 2358-2372.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!